Human TAAR1/TA1/ TAR1 ORF/cDNA clone-Lentivirus plasmid (NM_138327)
Pre-made Human TAAR1/TA1/ TAR1 Lentiviral expression plasmid for TAAR1 lentivirus packaging, TAAR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TAAR1/TA1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001582 | Human TAAR1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001582 |
Gene Name | TAAR1 |
Accession Number | NM_138327 |
Gene ID | 134864 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1020 bp |
Gene Alias | TA1, TAR1, TRAR1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATGCCCTTTTGCCACAATATAATTAATATTTCCTGTGTGAAAAACAACTGGTCAAATGATGTCCGTGCTTCCCTGTACAGTTTAATGGTGCTCATAATTCTGACCACACTCGTTGGCAATCTGATAGTTATTGTTTCTATATCACACTTCAAACAACTTCATACCCCAACAAATTGGCTCATTCATTCCATGGCCACTGTGGACTTTCTTCTGGGGTGTCTGGTCATGCCTTACAGTATGGTGAGATCTGCTGAGCACTGTTGGTATTTTGGAGAAGTCTTCTGTAAAATTCACACAAGCACCGACATTATGCTGAGCTCAGCCTCCATTTTCCATTTGTCTTTCATCTCCATTGACCGCTACTATGCTGTGTGTGATCCACTGAGATATAAAGCCAAGATGAATATCTTGGTTATTTGTGTGATGATCTTCATTAGTTGGAGTGTCCCTGCTGTTTTTGCATTTGGAATGATCTTTCTGGAGCTAAACTTCAAAGGCGCTGAAGAGATATATTACAAACATGTTCACTGCAGAGGAGGTTGCTCTGTCTTCTTTAGCAAAATATCTGGGGTACTGACCTTTATGACTTCTTTTTATATACCTGGATCTATTATGTTATGTGTCTATTACAGAATATATCTTATCGCTAAAGAACAGGCAAGATTAATTAGTGATGCCAATCAGAAGCTCCAAATTGGATTGGAAATGAAAAATGGAATTTCACAAAGCAAAGAAAGGAAAGCTGTGAAGACATTGGGGATTGTGATGGGAGTTTTCCTAATATGCTGGTGCCCTTTCTTTATCTGTACAGTCATGGACCCTTTTCTTCACTACATTATTCCACCTACTTTGAATGATGTATTGATTTGGTTTGGCTACTTGAACTCTACATTTAATCCAATGGTTTATGCATTTTTCTATCCTTGGTTTAGAAAAGCACTGAAGATGATGCTGTTTGGTAAAATTTTCCAAAAAGATTCATCCAGGTGTAAATTATTTTTGGAATTGAGTTCATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T99524-Ab | Anti-TAAR1/ TA1/ TAR1 monoclonal antibody |
Target Antigen | GM-Tg-g-T99524-Ag | TAAR1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001582 | Human TAAR1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001582 | Human TAAR1 Lentivirus particle |
Target information
Target ID | GM-T99524 |
Target Name | TAAR1 |
Gene ID | 134864, 111174, 708944, 113914, 101096731, 104969593, 106780887 |
Gene Symbol and Synonyms | TA1,TAAR1,taR-1,TAR1,TRAR1 |
Uniprot Accession | Q96RJ0 |
Uniprot Entry Name | TAAR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000146399 |
Target Classification | GPCR |
The protein encoded by this gene is a G-protein coupled receptor activated by trace amines. The encoded protein responds little or not at all to dopamine, serotonin, epinephrine, or histamine, but responds well to beta-phenylethylamine, p-tyramine, octopamine, and tryptamine. While primarily functioning in neurologic systems, there is evidence that this gene is involved in blood cell and immunologic functions as well. This gene is thought to be intronless. [provided by RefSeq, Nov 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.