Human TAAR1/TA1/ TAR1 ORF/cDNA clone-Lentivirus particle (NM_138327)

Pre-made Human TAAR1/TA1/ TAR1 Lentiviral expression plasmid for TAAR1 lentivirus packaging, TAAR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to TAAR1/TA1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001582 Human TAAR1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001582
Gene Name TAAR1
Accession Number NM_138327
Gene ID 134864
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1020 bp
Gene Alias TA1, TAR1, TRAR1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATGCCCTTTTGCCACAATATAATTAATATTTCCTGTGTGAAAAACAACTGGTCAAATGATGTCCGTGCTTCCCTGTACAGTTTAATGGTGCTCATAATTCTGACCACACTCGTTGGCAATCTGATAGTTATTGTTTCTATATCACACTTCAAACAACTTCATACCCCAACAAATTGGCTCATTCATTCCATGGCCACTGTGGACTTTCTTCTGGGGTGTCTGGTCATGCCTTACAGTATGGTGAGATCTGCTGAGCACTGTTGGTATTTTGGAGAAGTCTTCTGTAAAATTCACACAAGCACCGACATTATGCTGAGCTCAGCCTCCATTTTCCATTTGTCTTTCATCTCCATTGACCGCTACTATGCTGTGTGTGATCCACTGAGATATAAAGCCAAGATGAATATCTTGGTTATTTGTGTGATGATCTTCATTAGTTGGAGTGTCCCTGCTGTTTTTGCATTTGGAATGATCTTTCTGGAGCTAAACTTCAAAGGCGCTGAAGAGATATATTACAAACATGTTCACTGCAGAGGAGGTTGCTCTGTCTTCTTTAGCAAAATATCTGGGGTACTGACCTTTATGACTTCTTTTTATATACCTGGATCTATTATGTTATGTGTCTATTACAGAATATATCTTATCGCTAAAGAACAGGCAAGATTAATTAGTGATGCCAATCAGAAGCTCCAAATTGGATTGGAAATGAAAAATGGAATTTCACAAAGCAAAGAAAGGAAAGCTGTGAAGACATTGGGGATTGTGATGGGAGTTTTCCTAATATGCTGGTGCCCTTTCTTTATCTGTACAGTCATGGACCCTTTTCTTCACTACATTATTCCACCTACTTTGAATGATGTATTGATTTGGTTTGGCTACTTGAACTCTACATTTAATCCAATGGTTTATGCATTTTTCTATCCTTGGTTTAGAAAAGCACTGAAGATGATGCTGTTTGGTAAAATTTTCCAAAAAGATTCATCCAGGTGTAAATTATTTTTGGAATTGAGTTCATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T99524-Ab Anti-TAAR1/ TA1/ TAR1 monoclonal antibody
    Target Antigen GM-Tg-g-T99524-Ag TAAR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001582 Human TAAR1 Lentivirus plasmid
    ORF Viral Vector vGMLP001582 Human TAAR1 Lentivirus particle


    Target information

    Target ID GM-T99524
    Target Name TAAR1
    Gene ID 134864, 111174, 708944, 113914, 101096731, 104969593, 106780887
    Gene Symbol and Synonyms TA1,TAAR1,taR-1,TAR1,TRAR1
    Uniprot Accession Q96RJ0
    Uniprot Entry Name TAAR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000146399
    Target Classification GPCR

    The protein encoded by this gene is a G-protein coupled receptor activated by trace amines. The encoded protein responds little or not at all to dopamine, serotonin, epinephrine, or histamine, but responds well to beta-phenylethylamine, p-tyramine, octopamine, and tryptamine. While primarily functioning in neurologic systems, there is evidence that this gene is involved in blood cell and immunologic functions as well. This gene is thought to be intronless. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.