Human TMEFF2/CT120.2/ HPP1 ORF/cDNA clone-Lentivirus plasmid (NM_016192)
Pre-made Human TMEFF2/CT120.2/ HPP1 Lentiviral expression plasmid for TMEFF2 lentivirus packaging, TMEFF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TMEFF2/CT120.2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001589 | Human TMEFF2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001589 |
Gene Name | TMEFF2 |
Accession Number | NM_016192 |
Gene ID | 23671 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1125 bp |
Gene Alias | CT120.2, HPP1, TENB2, TPEF, TR, TR-2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTGCTGTGGGAGTCCCCGCGGCAGTGCAGCAGCTGGACACTTTGCGAGGGCTTTTGCTGGCTGCTGCTGCTGCCCGTCATGCTACTCATCGTAGCCCGCCCGGTGAAGCTCGCTGCTTTCCCTACCTCCTTAAGTGACTGCCAAACGCCCACCGGCTGGAATTGCTCTGGTTATGATGACAGAGAAAATGATCTCTTCCTCTGTGACACCAACACCTGTAAATTTGATGGGGAATGTTTAAGAATTGGAGACACTGTGACTTGCGTCTGTCAGTTCAAGTGCAACAATGACTATGTGCCTGTGTGTGGCTCCAATGGGGAGAGCTACCAGAATGAGTGTTACCTGCGACAGGCTGCATGCAAACAGCAGAGTGAGATACTTGTGGTGTCAGAAGGATCATGTGCCACAGATGCAGGATCAGGATCTGGAGATGGAGTCCATGAAGGCTCTGGAGAAACTAGTCAAAAGGAGACATCCACCTGTGATATTTGCCAGTTTGGTGCAGAATGTGACGAAGATGCCGAGGATGTCTGGTGTGTGTGTAATATTGACTGTTCTCAAACCAACTTCAATCCCCTCTGCGCTTCTGATGGGAAATCTTATGATAATGCATGCCAAATCAAAGAAGCATCGTGTCAGAAACAGGAGAAAATTGAAGTCATGTCTTTGGGTCGATGTCAAGATAACACAACTACAACTACTAAGTCTGAAGATGGGCATTATGCAAGAACAGATTATGCAGAGAATGCTAACAAATTAGAAGAAAGTGCCAGAGAACACCACATACCTTGTCCGGAACATTACAATGGCTTCTGCATGCATGGGAAGTGTGAGCATTCTATCAATATGCAGGAGCCATCTTGCAGGTGTGATGCTGGTTATACTGGACAACACTGTGAAAAAAAGGACTACAGTGTTCTATACGTTGTTCCCGGTCCTGTACGATTTCAGTATGTCTTAATCGCAGCTGTGATTGGAACAATTCAGATTGCTGTCATCTGTGTGGTGGTCCTCTGCATCACAAGGAAATGCCCCAGAAGCAACAGAATTCACAGACAGAAGCAAAATACAGGGCACTACAGTTCAGACAATACAACAAGAGCGTCCACGAGGTTAATCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1810-Ab | Anti-TEFF2/ TMEFF2/ CT120.2 monoclonal antibody |
Target Antigen | GM-Tg-g-MP1810-Ag | TMEFF2 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP1810 | Transmembrane protein with EGF-like and two follistatin-like domains 2 (TMEFF2) protein & antibody |
ORF Viral Vector | pGMLP001589 | Human TMEFF2 Lentivirus plasmid |
ORF Viral Vector | vGMLP001589 | Human TMEFF2 Lentivirus particle |
Target information
Target ID | GM-MP1810 |
Target Name | TMEFF2 |
Gene ID | 23671, 56363, 694555, 363228, 101085308, 478848, 538354, 100054833 |
Gene Symbol and Synonyms | 4832418D20Rik,7630402F16Rik,CT120.2,HPP1,TENB2,TMEFF2,TPEF,TR,TR-2 |
Uniprot Accession | Q9UIK5 |
Uniprot Entry Name | TEFF2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Esophagus Cancer |
Gene Ensembl | ENSG00000144339 |
Target Classification | Not Available |
This gene encodes a member of the tomoregulin family of transmembrane proteins. This protein has been shown to function as both an oncogene and a tumor suppressor depending on the cellular context and may regulate prostate cancer cell invasion. Multiple soluble forms of this protein have been identified that arise from both an alternative splice variant and ectodomain shedding. Additionally, this gene has been found to be hypermethylated in multiple cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.