Human TMEFF2/CT120.2/ HPP1 ORF/cDNA clone-Lentivirus particle (NM_016192)

Pre-made Human TMEFF2/CT120.2/ HPP1 Lentiviral expression plasmid for TMEFF2 lentivirus packaging, TMEFF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to TMEFF2/CT120.2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001589 Human TMEFF2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001589
Gene Name TMEFF2
Accession Number NM_016192
Gene ID 23671
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1125 bp
Gene Alias CT120.2, HPP1, TENB2, TPEF, TR, TR-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTGCTGTGGGAGTCCCCGCGGCAGTGCAGCAGCTGGACACTTTGCGAGGGCTTTTGCTGGCTGCTGCTGCTGCCCGTCATGCTACTCATCGTAGCCCGCCCGGTGAAGCTCGCTGCTTTCCCTACCTCCTTAAGTGACTGCCAAACGCCCACCGGCTGGAATTGCTCTGGTTATGATGACAGAGAAAATGATCTCTTCCTCTGTGACACCAACACCTGTAAATTTGATGGGGAATGTTTAAGAATTGGAGACACTGTGACTTGCGTCTGTCAGTTCAAGTGCAACAATGACTATGTGCCTGTGTGTGGCTCCAATGGGGAGAGCTACCAGAATGAGTGTTACCTGCGACAGGCTGCATGCAAACAGCAGAGTGAGATACTTGTGGTGTCAGAAGGATCATGTGCCACAGATGCAGGATCAGGATCTGGAGATGGAGTCCATGAAGGCTCTGGAGAAACTAGTCAAAAGGAGACATCCACCTGTGATATTTGCCAGTTTGGTGCAGAATGTGACGAAGATGCCGAGGATGTCTGGTGTGTGTGTAATATTGACTGTTCTCAAACCAACTTCAATCCCCTCTGCGCTTCTGATGGGAAATCTTATGATAATGCATGCCAAATCAAAGAAGCATCGTGTCAGAAACAGGAGAAAATTGAAGTCATGTCTTTGGGTCGATGTCAAGATAACACAACTACAACTACTAAGTCTGAAGATGGGCATTATGCAAGAACAGATTATGCAGAGAATGCTAACAAATTAGAAGAAAGTGCCAGAGAACACCACATACCTTGTCCGGAACATTACAATGGCTTCTGCATGCATGGGAAGTGTGAGCATTCTATCAATATGCAGGAGCCATCTTGCAGGTGTGATGCTGGTTATACTGGACAACACTGTGAAAAAAAGGACTACAGTGTTCTATACGTTGTTCCCGGTCCTGTACGATTTCAGTATGTCTTAATCGCAGCTGTGATTGGAACAATTCAGATTGCTGTCATCTGTGTGGTGGTCCTCTGCATCACAAGGAAATGCCCCAGAAGCAACAGAATTCACAGACAGAAGCAAAATACAGGGCACTACAGTTCAGACAATACAACAAGAGCGTCCACGAGGTTAATCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1810-Ab Anti-TEFF2/ TMEFF2/ CT120.2 monoclonal antibody
    Target Antigen GM-Tg-g-MP1810-Ag TMEFF2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP1810 Transmembrane protein with EGF-like and two follistatin-like domains 2 (TMEFF2) protein & antibody
    ORF Viral Vector pGMLP001589 Human TMEFF2 Lentivirus plasmid
    ORF Viral Vector vGMLP001589 Human TMEFF2 Lentivirus particle


    Target information

    Target ID GM-MP1810
    Target Name TMEFF2
    Gene ID 23671, 56363, 694555, 363228, 101085308, 478848, 538354, 100054833
    Gene Symbol and Synonyms 4832418D20Rik,7630402F16Rik,CT120.2,HPP1,TENB2,TMEFF2,TPEF,TR,TR-2
    Uniprot Accession Q9UIK5
    Uniprot Entry Name TEFF2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Esophagus Cancer
    Gene Ensembl ENSG00000144339
    Target Classification Not Available

    This gene encodes a member of the tomoregulin family of transmembrane proteins. This protein has been shown to function as both an oncogene and a tumor suppressor depending on the cellular context and may regulate prostate cancer cell invasion. Multiple soluble forms of this protein have been identified that arise from both an alternative splice variant and ectodomain shedding. Additionally, this gene has been found to be hypermethylated in multiple cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.