Human CGB3/CGB/ CGB5 ORF/cDNA clone-Lentivirus plasmid (NM_000737)

Pre-made Human CGB3/CGB/ CGB5 Lentiviral expression plasmid for CGB3 lentivirus packaging, CGB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CG-beta/CGB3/CGB products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001861 Human CGB3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001861
Gene Name CGB3
Accession Number NM_000737
Gene ID 1082
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 498 bp
Gene Alias CGB, CGB5, CGB7, CGB8, hCGB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGATGTTCCAGGGGCTGCTGCTGTTGCTGCTGCTGAGCATGGGCGGGACATGGGCATCCAAGGAGCCGCTTCGGCCACGGTGCCGCCCCATCAATGCCACCCTGGCTGTGGAGAAGGAGGGCTGCCCCGTGTGCATCACCGTCAACACCACCATCTGTGCCGGCTACTGCCCCACCATGACCCGCGTGCTGCAGGGGGTCCTGCCGGCCCTGCCTCAGGTGGTGTGCAACTACCGCGATGTGCGCTTCGAGTCCATCCGGCTCCCTGGCTGCCCGCGCGGCGTGAACCCCGTGGTCTCCTACGCCGTGGCTCTCAGCTGTCAATGTGCACTCTGCCGCCGCAGCACCACTGACTGCGGGGGTCCCAAGGACCACCCCTTGACCTGTGATGACCCCCGCTTCCAGGACTCCTCTTCCTCAAAGGCCCCTCCCCCCAGCCTTCCAAGCCCATCCCGACTCCCGGGGCCCTCGGACACCCCGATCCTCCCACAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T06575-Ab Anti-CGB3/ CG-beta/ CGB functional antibody
    Target Antigen GM-Tg-g-T06575-Ag CG-beta/CGB3 protein
    ORF Viral Vector pGMLP000518 Human CGB5 Lentivirus plasmid
    ORF Viral Vector pGMLP000845 Human CGB3 Lentivirus plasmid
    ORF Viral Vector pGMLP001861 Human CGB3 Lentivirus plasmid
    ORF Viral Vector pGMAP000226 Human CGB5 Adenovirus plasmid
    ORF Viral Vector pGMAP000262 Human CGB3 Adenovirus plasmid
    ORF Viral Vector pGMAP000482 Human CGB5 Adenovirus plasmid
    ORF Viral Vector vGMLP000518 Human CGB5 Lentivirus particle
    ORF Viral Vector vGMLP000845 Human CGB3 Lentivirus particle
    ORF Viral Vector vGMLP001861 Human CGB3 Lentivirus particle
    ORF Viral Vector vGMAP000226 Human CGB5 Adenovirus particle
    ORF Viral Vector vGMAP000262 Human CGB3 Adenovirus particle
    ORF Viral Vector vGMAP000482 Human CGB5 Adenovirus particle


    Target information

    Target ID GM-T06575
    Target Name CG-beta
    Gene ID 1082
    Gene Symbol and Synonyms CGB,CGB3,CGB5,CGB7,CGB8,hCGB,LHB
    Uniprot Accession P0DN86
    Uniprot Entry Name CGB3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000104827
    Target Classification Not Available

    This gene is a member of the glycoprotein hormone beta chain family and encodes the beta 3 subunit of chorionic gonadotropin (CG). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.