Human CGB5/HCG ORF/cDNA clone-Adenovirus plasmid (BC006290)
Pre-made Human CGB5/HCG adenoviral expression plasmid for CGB5 adenovirus packaging, CGB5 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to CG-beta/CGB5/HCG products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000226 | Human CGB5 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000226 |
Gene Name | CGB5 |
Accession Number | BC006290 |
Gene ID | 93659 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 498 bp |
Gene Alias | HCG |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGATGTTCCAGGGGCTGCTGCTGTTGCTGCTGCTGAGCATGGGCGGGACATGGGCATCCAAGGAGCCGCTTCGGCCACGGTGCCGCCCCATCAATGCCACCCTGGCTGTGGAGAAGGAGGGCTGCCCCGTGTGCATCACCGTCAACACCACCATCTGTGCCGGCTACTGCCCCACCATGACCCGCGTGCTGCAGGGGGTCCTGCCGGCCCTGCCTCAGGTGGTGTGCAACTACCGCGATGTGCGCTTCGAGTCCATCCGGCTCCCTGGCTGCCCGCGCGGCGTGAACCCCGTGGTCTCCTACGCCGTGGCTCTCAGCTGTCAATGTGCACTCTGCCGCCGCAGCACCACTGACTGCGGGGGTCCCAAGGACCACCCCTTGACCTGTGATGACCCCCGCTTCCAGGACTCCTCTTCCTCAAAGGCCCCTCCCCCCAGCCTTCCAAGTCCATCCCGACTCCCGGGGCCCTCGGACACCCCGATCCTCCCACAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T06575-Ab | Anti-CGB3/ CG-beta/ CGB functional antibody |
Target Antigen | GM-Tg-g-T06575-Ag | CG-beta/CGB3 protein |
ORF Viral Vector | pGMLP000518 | Human CGB5 Lentivirus plasmid |
ORF Viral Vector | pGMLP000845 | Human CGB3 Lentivirus plasmid |
ORF Viral Vector | pGMLP001861 | Human CGB3 Lentivirus plasmid |
ORF Viral Vector | pGMAP000226 | Human CGB5 Adenovirus plasmid |
ORF Viral Vector | pGMAP000262 | Human CGB3 Adenovirus plasmid |
ORF Viral Vector | pGMAP000482 | Human CGB5 Adenovirus plasmid |
ORF Viral Vector | vGMLP000518 | Human CGB5 Lentivirus particle |
ORF Viral Vector | vGMLP000845 | Human CGB3 Lentivirus particle |
ORF Viral Vector | vGMLP001861 | Human CGB3 Lentivirus particle |
ORF Viral Vector | vGMAP000226 | Human CGB5 Adenovirus particle |
ORF Viral Vector | vGMAP000262 | Human CGB3 Adenovirus particle |
ORF Viral Vector | vGMAP000482 | Human CGB5 Adenovirus particle |
Target information
Target ID | GM-T06575 |
Target Name | CG-beta |
Gene ID | 1082 |
Gene Symbol and Synonyms | CGB,CGB3,CGB5,CGB7,CGB8,hCGB,LHB |
Uniprot Accession | P0DN86 |
Uniprot Entry Name | CGB3_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000104827 |
Target Classification | Not Available |
This gene is a member of the glycoprotein hormone beta chain family and encodes the beta 3 subunit of chorionic gonadotropin (CG). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.