Human CXCL10/C7/ crg-2 ORF/cDNA clone-Lentivirus plasmid (NM_001565.3)
Pre-made Human CXCL10/C7/ crg-2 Lentiviral expression plasmid for CXCL10 lentivirus packaging, CXCL10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CXCL10/C7 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001931 | Human CXCL10 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001931 |
Gene Name | CXCL10 |
Accession Number | NM_001565.3 |
Gene ID | 3627 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 297 bp |
Gene Alias | C7, crg-2, gIP-10, IFI10, INP10, IP-10, mob-1, SCYB10 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAATCAAACTGCCATTCTGATTTGCTGCCTTATCTTTCTGACTCTAAGTGGCATTCAAGGAGTACCTCTCTCTAGAACTGTACGCTGTACCTGCATCAGCATTAGTAATCAACCTGTTAATCCAAGGTCTTTAGAAAAACTTGAAATTATTCCTGCAAGCCAATTTTGTCCACGTGTTGAGATCATTGCTACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGAATCCAGAATCGAAGGCCATCAAGAATTTACTGAAAGCAGTTAGCAAGGAAAGGTCTAAAAGATCTCCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-168 | Pre-Made Eldelumab biosimilar, Whole mAb, Anti-CXCL10 Antibody: Anti-C7/IFI10/INP10/IP-10/SCYB10/crg-2/gIP-10/mob-1 therapeutic antibody |
Target Antibody | GM-Tg-g-T30635-Ab | Anti-CXL10/ CXCL10/ C7 functional antibody |
Target Antigen | GM-Tg-g-T30635-Ag | CXCL10 protein |
Cytokine | cks-Tg-g-GM-T30635 | chemokine (C-X-C motif) ligand 10 (CXCL10) protein & antibody |
ORF Viral Vector | pGMLP001931 | Human CXCL10 Lentivirus plasmid |
ORF Viral Vector | pGMAP000053 | Human CXCL10 Adenovirus plasmid |
ORF Viral Vector | vGMLP001931 | Human CXCL10 Lentivirus particle |
ORF Viral Vector | vGMAP000053 | Human CXCL10 Adenovirus particle |
Target information
Target ID | GM-T30635 |
Target Name | CXCL10 |
Gene ID | 3627, 574243, 245920, 101100131, 478432, 615107, 100050993 |
Gene Symbol and Synonyms | C7,crg-2,CXCL10,gIP-10,IFI10,INP10,IP-10,mob-1,SCYB10 |
Uniprot Accession | P02778 |
Uniprot Entry Name | CXL10_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Breast Cancer, Complications of kidney transplant, Bacterial sepsis of newborn, Acute kidney failure |
Gene Ensembl | ENSG00000169245 |
Target Classification | Not Available |
This antimicrobial gene encodes a chemokine of the CXC subfamily and ligand for the receptor CXCR3. Binding of this protein to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. This gene may also be a key regulator of the 'cytokine storm' immune response to SARS-CoV-2 infection. [provided by RefSeq, Sep 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.