Human CXCL10/C7/ crg-2 ORF/cDNA clone-Adenovirus plasmid (BC010954)

Pre-made Human CXCL10/C7/ crg-2 adenoviral expression plasmid for CXCL10 adenovirus packaging, CXCL10 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CXCL10/C7 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000053 Human CXCL10 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000053
Gene Name CXCL10
Accession Number BC010954
Gene ID 3627
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 297 bp
Gene Alias C7, crg-2, gIP-10, IFI10, IP-10, mob-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAATCAAACTGCCATTCTGATTTGCTGCCTTATCTTTCTGACTCTAAGTGGCATTCAAGGAGTACCTCTCTCTAGAACTGTACGCTGTACCTGCATCAGCATTAGTAATCAACCTGTTAATCCAAGGTCTTTAGAAAAACTTGAAATTATTCCTGCAAGCCAATTTTGTCCACGTGTTGAGATCATTGCTACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGAATCCAGAATCGAAGGCCATCAAGAATTTACTGAAAGCAGTTAGCAAGGAAAGGTCTAAAAGATCTCCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-168 Pre-Made Eldelumab biosimilar, Whole mAb, Anti-CXCL10 Antibody: Anti-C7/IFI10/INP10/IP-10/SCYB10/crg-2/gIP-10/mob-1 therapeutic antibody
    Target Antibody GM-Tg-g-T30635-Ab Anti-CXL10/ CXCL10/ C7 functional antibody
    Target Antigen GM-Tg-g-T30635-Ag CXCL10 protein
    Cytokine cks-Tg-g-GM-T30635 chemokine (C-X-C motif) ligand 10 (CXCL10) protein & antibody
    ORF Viral Vector pGMLP001931 Human CXCL10 Lentivirus plasmid
    ORF Viral Vector pGMAP000053 Human CXCL10 Adenovirus plasmid
    ORF Viral Vector vGMLP001931 Human CXCL10 Lentivirus particle
    ORF Viral Vector vGMAP000053 Human CXCL10 Adenovirus particle


    Target information

    Target ID GM-T30635
    Target Name CXCL10
    Gene ID 3627, 574243, 245920, 101100131, 478432, 615107, 100050993
    Gene Symbol and Synonyms C7,crg-2,CXCL10,gIP-10,IFI10,INP10,IP-10,mob-1,SCYB10
    Uniprot Accession P02778
    Uniprot Entry Name CXL10_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Breast Cancer, Complications of kidney transplant, Bacterial sepsis of newborn, Acute kidney failure
    Gene Ensembl ENSG00000169245
    Target Classification Not Available

    This antimicrobial gene encodes a chemokine of the CXC subfamily and ligand for the receptor CXCR3. Binding of this protein to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. This gene may also be a key regulator of the 'cytokine storm' immune response to SARS-CoV-2 infection. [provided by RefSeq, Sep 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.