Human LGALS1/GAL1/GBP ORF/cDNA clone-Lentivirus plasmid (NM_002305.3)

Cat. No.: pGMLP001964
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LGALS1/GAL1/GBP Lentiviral expression plasmid for LGALS1 lentivirus packaging, LGALS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to LGALS1/GAL1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001964
Gene Name LGALS1
Accession Number NM_002305.3
Gene ID 3956
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 408 bp
Gene Alias GAL1,GBP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA
ORF Protein Sequence MACGLVASNLNLKPGECLRVRGEVAPDAKSFVLNLGKDSNNLCLHFNPRFNAHGDANTIVCNSKDGGAWGTEQREAVFPFQPGSVAEVCITFDQANLTVKLPDGYEFKFPNRLNLEAINYMAADGDFKIKCVAFD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T09544-Ab Anti-LEG1/ LGALS1/ GAL1 functional antibody
    Target Antigen GM-Tg-g-T09544-Ag LGALS1 protein
    ORF Viral Vector pGMLP001964 Human LGALS1 Lentivirus plasmid
    ORF Viral Vector pGMAD000545 Human LGALS1 Adenovirus plasmid
    ORF Viral Vector pGMAAV000234 Human LGALS1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000003 Human LGALS1 Adenovirus plasmid
    ORF Viral Vector vGMLP001964 Human LGALS1 Lentivirus particle
    ORF Viral Vector vGMAD000545 Human LGALS1 Adenovirus particle
    ORF Viral Vector vGMAAV000234 Human LGALS1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000003 Human LGALS1 Adenovirus particle


    Target information

    Target ID GM-T09544
    Target Name LGALS1
    Gene ID 3956, 16852, 56646, 101098151, 610276, 326598, 100069841
    Gene Symbol and Synonyms Gal-1,GAL1,Galbp,galectin-1,GBP,L-14.5,L14,Lect14,LGALS1
    Uniprot Accession P09382
    Uniprot Entry Name LEG1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target
    Disease Congenital occlusion of ureteropelvic junction
    Gene Ensembl ENSG00000100097
    Target Classification Checkpoint-Immuno Oncology

    The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.