Human LGALS1/GAL1/ GBP ORF/cDNA clone-Adenovirus plasmid (BC001693)
Pre-made Human LGALS1/GAL1/ GBP adenoviral expression plasmid for LGALS1 adenovirus packaging, LGALS1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to LGALS1/GAL1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000003 | Human LGALS1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000003 |
Gene Name | LGALS1 |
Accession Number | BC001693 |
Gene ID | 3956 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 408 bp |
Gene Alias | GAL1, GBP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T09544-Ab | Anti-LEG1/ LGALS1/ GAL1 functional antibody |
Target Antigen | GM-Tg-g-T09544-Ag | LGALS1 protein |
ORF Viral Vector | pGMAD000545 | Human LGALS1 Adenovirus plasmid |
ORF Viral Vector | pGMAAV000234 | Human LGALS1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP001964 | Human LGALS1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000003 | Human LGALS1 Adenovirus plasmid |
ORF Viral Vector | vGMAD000545 | Human LGALS1 Adenovirus particle |
ORF Viral Vector | vGMAAV000234 | Human LGALS1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP001964 | Human LGALS1 Lentivirus particle |
ORF Viral Vector | vGMAP000003 | Human LGALS1 Adenovirus particle |
Target information
Target ID | GM-T09544 |
Target Name | LGALS1 |
Gene ID | 3956, 16852, 56646, 101098151, 610276, 326598, 100069841 |
Gene Symbol and Synonyms | Gal-1,GAL1,Galbp,galectin-1,GBP,L-14.5,L14,Lect14,LGALS1 |
Uniprot Accession | P09382 |
Uniprot Entry Name | LEG1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Congenital occlusion of ureteropelvic junction |
Gene Ensembl | ENSG00000100097 |
Target Classification | Checkpoint-Immuno Oncology |
The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.