Human LGALS1/GAL1/GBP ORF/cDNA clone-Adenovirus particle (BC001693)

Cat. No.: vGMAP000003

Pre-made Human LGALS1/GAL1/GBP Adenovirus for LGALS1 overexpression in-vitro and in-vivo. The LGALS1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified LGALS1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to LGALS1/GAL1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000003 Human LGALS1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000003
Gene Name LGALS1
Accession Number BC001693
Gene ID 3956
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 408 bp
Gene Alias GAL1,GBP
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA
ORF Protein Sequence MACGLVASNLNLKPGECLRVRGEVAPDAKSFVLNLGKDSNNLCLHFNPRFNAHGDANTIVCNSKDGGAWGTEQREAVFPFQPGSVAEVCITFDQANLTVKLPDGYEFKFPNRLNLEAINYMAADGDFKIKCVAFD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T09544-Ab Anti-LEG1/ LGALS1/ GAL1 functional antibody
    Target Antigen GM-Tg-g-T09544-Ag LGALS1 protein
    ORF Viral Vector pGMLP001964 Human LGALS1 Lentivirus plasmid
    ORF Viral Vector pGMAD000545 Human LGALS1 Adenovirus plasmid
    ORF Viral Vector pGMAAV000234 Human LGALS1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000003 Human LGALS1 Adenovirus plasmid
    ORF Viral Vector vGMLP001964 Human LGALS1 Lentivirus particle
    ORF Viral Vector vGMAD000545 Human LGALS1 Adenovirus particle
    ORF Viral Vector vGMAAV000234 Human LGALS1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000003 Human LGALS1 Adenovirus particle


    Target information

    Target ID GM-T09544
    Target Name LGALS1
    Gene ID 3956, 16852, 56646, 101098151, 610276, 326598, 100069841
    Gene Symbol and Synonyms Gal-1,GAL1,Galbp,galectin-1,GBP,L-14.5,L14,Lect14,LGALS1
    Uniprot Accession P09382
    Uniprot Entry Name LEG1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target
    Disease Congenital occlusion of ureteropelvic junction
    Gene Ensembl ENSG00000100097
    Target Classification Checkpoint-Immuno Oncology

    The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.