Human LGALS1/GAL1/ GBP ORF/cDNA clone-Adenovirus particle (NM_002305)
Pre-made Human LGALS1/GAL1/ GBP Adenovirus for LGALS1 overexpression in-vitro and in-vivo. The LGALS1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified LGALS1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to LGALS1/GAL1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000545 | Human LGALS1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000545 |
Gene Name | LGALS1 |
Accession Number | NM_002305 |
Gene ID | 3956 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 408 bp |
Gene Alias | GAL1, GBP |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T09544-Ab | Anti-LEG1/ LGALS1/ GAL1 functional antibody |
Target Antigen | GM-Tg-g-T09544-Ag | LGALS1 protein |
ORF Viral Vector | pGMAD000545 | Human LGALS1 Adenovirus plasmid |
ORF Viral Vector | pGMAAV000234 | Human LGALS1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP001964 | Human LGALS1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000003 | Human LGALS1 Adenovirus plasmid |
ORF Viral Vector | vGMAD000545 | Human LGALS1 Adenovirus particle |
ORF Viral Vector | vGMAAV000234 | Human LGALS1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP001964 | Human LGALS1 Lentivirus particle |
ORF Viral Vector | vGMAP000003 | Human LGALS1 Adenovirus particle |
Target information
Target ID | GM-T09544 |
Target Name | LGALS1 |
Gene ID | 3956, 16852, 56646, 101098151, 610276, 326598, 100069841 |
Gene Symbol and Synonyms | Gal-1,GAL1,Galbp,galectin-1,GBP,L-14.5,L14,Lect14,LGALS1 |
Uniprot Accession | P09382 |
Uniprot Entry Name | LEG1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Congenital occlusion of ureteropelvic junction |
Gene Ensembl | ENSG00000100097 |
Target Classification | Checkpoint-Immuno Oncology |
The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.