Human S1PR1/CD363/ CHEDG1 ORF/cDNA clone-Lentivirus plasmid (NM_001400.4)
Pre-made Human S1PR1/CD363/ CHEDG1 Lentiviral expression plasmid for S1PR1 lentivirus packaging, S1PR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to S1PR1/CD363 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002001 | Human S1PR1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002001 |
Gene Name | S1PR1 |
Accession Number | NM_001400.4 |
Gene ID | 1901 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1149 bp |
Gene Alias | CD363, CHEDG1, D1S3362, ECGF1, EDG-1, EDG1, S1P1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGCCCACCAGCGTCCCGCTGGTCAAGGCCCACCGCAGCTCGGTCTCTGACTACGTCAACTATGATATCATCGTCCGGCATTACAACTACACGGGAAAGCTGAATATCAGCGCGGACAAGGAGAACAGCATTAAACTGACCTCGGTGGTGTTCATTCTCATCTGCTGCTTTATCATCCTGGAGAACATCTTTGTCTTGCTGACCATTTGGAAAACCAAGAAATTCCACCGACCCATGTACTATTTTATTGGCAATCTGGCCCTCTCAGACCTGTTGGCAGGAGTAGCCTACACAGCTAACCTGCTCTTGTCTGGGGCCACCACCTACAAGCTCACTCCCGCCCAGTGGTTTCTGCGGGAAGGGAGTATGTTTGTGGCCCTGTCAGCCTCCGTGTTCAGTCTCCTCGCCATCGCCATTGAGCGCTATATCACAATGCTGAAAATGAAACTCCACAACGGGAGCAATAACTTCCGCCTCTTCCTGCTAATCAGCGCCTGCTGGGTCATCTCCCTCATCCTGGGTGGCCTGCCTATCATGGGCTGGAACTGCATCAGTGCGCTGTCCAGCTGCTCCACCGTGCTGCCGCTCTACCACAAGCACTATATCCTCTTCTGCACCACGGTCTTCACTCTGCTTCTGCTCTCCATCGTCATTCTGTACTGCAGAATCTACTCCTTGGTCAGGACTCGGAGCCGCCGCCTGACGTTCCGCAAGAACATTTCCAAGGCCAGCCGCAGCTCTGAGAAGTCGCTGGCGCTGCTCAAGACCGTAATTATCGTCCTGAGCGTCTTCATCGCCTGCTGGGCACCGCTCTTCATCCTGCTCCTGCTGGATGTGGGCTGCAAGGTGAAGACCTGTGACATCCTCTTCAGAGCGGAGTACTTCCTGGTGTTAGCTGTGCTCAACTCCGGCACCAACCCCATCATTTACACTCTGACCAACAAGGAGATGCGTCGGGCCTTCATCCGGATCATGTCCTGCTGCAAGTGCCCGAGCGGAGACTCTGCTGGCAAATTCAAGCGACCCATCATCGCCGGCATGGAATTCAGCCGCAGCAAATCGGACAATTCCTCCCACCCCCAGAAAGACGAAGGGGACAACCCAGAGACCATTATGTCTTCTGGAAACGTCAACTCTTCTTCCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T13852-Ab | Anti-S1PR1/ CD363/ CHEDG1 monoclonal antibody |
Target Antigen | GM-Tg-g-T13852-Ag | S1PR1 VLP (virus-like particle) |
ORF Viral Vector | pGMAAV000276 | Rat S1pr1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP002001 | Human S1PR1 Lentivirus plasmid |
ORF Viral Vector | vGMAAV000276 | Rat S1pr1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP002001 | Human S1PR1 Lentivirus particle |
Target information
Target ID | GM-T13852 |
Target Name | S1PR1 |
Gene ID | 1901, 13609, 716813, 29733, 101091218, 490138, 281135, 100050049 |
Gene Symbol and Synonyms | CD363,CHEDG1,D1S3362,ECGF1,EDG-1,EDG1,Lpb1,S1p,S1P1,S1PR1 |
Uniprot Accession | P21453 |
Uniprot Entry Name | S1PR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000170989 |
Target Classification | GPCR |
The protein encoded by this gene is structurally similar to G protein-coupled receptors and is highly expressed in endothelial cells. It binds the ligand sphingosine-1-phosphate with high affinity and high specificity, and suggested to be involved in the processes that regulate the differentiation of endothelial cells. Activation of this receptor induces cell-cell adhesion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.