Human S1PR1/CD363/ CHEDG1 ORF/cDNA clone-Lentivirus particle (NM_001400.4)

Pre-made Human S1PR1/CD363/ CHEDG1 Lentiviral expression plasmid for S1PR1 lentivirus packaging, S1PR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to S1PR1/CD363 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002001 Human S1PR1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002001
Gene Name S1PR1
Accession Number NM_001400.4
Gene ID 1901
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1149 bp
Gene Alias CD363, CHEDG1, D1S3362, ECGF1, EDG-1, EDG1, S1P1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGCCCACCAGCGTCCCGCTGGTCAAGGCCCACCGCAGCTCGGTCTCTGACTACGTCAACTATGATATCATCGTCCGGCATTACAACTACACGGGAAAGCTGAATATCAGCGCGGACAAGGAGAACAGCATTAAACTGACCTCGGTGGTGTTCATTCTCATCTGCTGCTTTATCATCCTGGAGAACATCTTTGTCTTGCTGACCATTTGGAAAACCAAGAAATTCCACCGACCCATGTACTATTTTATTGGCAATCTGGCCCTCTCAGACCTGTTGGCAGGAGTAGCCTACACAGCTAACCTGCTCTTGTCTGGGGCCACCACCTACAAGCTCACTCCCGCCCAGTGGTTTCTGCGGGAAGGGAGTATGTTTGTGGCCCTGTCAGCCTCCGTGTTCAGTCTCCTCGCCATCGCCATTGAGCGCTATATCACAATGCTGAAAATGAAACTCCACAACGGGAGCAATAACTTCCGCCTCTTCCTGCTAATCAGCGCCTGCTGGGTCATCTCCCTCATCCTGGGTGGCCTGCCTATCATGGGCTGGAACTGCATCAGTGCGCTGTCCAGCTGCTCCACCGTGCTGCCGCTCTACCACAAGCACTATATCCTCTTCTGCACCACGGTCTTCACTCTGCTTCTGCTCTCCATCGTCATTCTGTACTGCAGAATCTACTCCTTGGTCAGGACTCGGAGCCGCCGCCTGACGTTCCGCAAGAACATTTCCAAGGCCAGCCGCAGCTCTGAGAAGTCGCTGGCGCTGCTCAAGACCGTAATTATCGTCCTGAGCGTCTTCATCGCCTGCTGGGCACCGCTCTTCATCCTGCTCCTGCTGGATGTGGGCTGCAAGGTGAAGACCTGTGACATCCTCTTCAGAGCGGAGTACTTCCTGGTGTTAGCTGTGCTCAACTCCGGCACCAACCCCATCATTTACACTCTGACCAACAAGGAGATGCGTCGGGCCTTCATCCGGATCATGTCCTGCTGCAAGTGCCCGAGCGGAGACTCTGCTGGCAAATTCAAGCGACCCATCATCGCCGGCATGGAATTCAGCCGCAGCAAATCGGACAATTCCTCCCACCCCCAGAAAGACGAAGGGGACAACCCAGAGACCATTATGTCTTCTGGAAACGTCAACTCTTCTTCCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T13852-Ab Anti-S1PR1/ CD363/ CHEDG1 monoclonal antibody
    Target Antigen GM-Tg-g-T13852-Ag S1PR1 VLP (virus-like particle)
    ORF Viral Vector pGMAAV000276 Rat S1pr1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP002001 Human S1PR1 Lentivirus plasmid
    ORF Viral Vector vGMAAV000276 Rat S1pr1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP002001 Human S1PR1 Lentivirus particle


    Target information

    Target ID GM-T13852
    Target Name S1PR1
    Gene ID 1901, 13609, 716813, 29733, 101091218, 490138, 281135, 100050049
    Gene Symbol and Synonyms CD363,CHEDG1,D1S3362,ECGF1,EDG-1,EDG1,Lpb1,S1p,S1P1,S1PR1
    Uniprot Accession P21453
    Uniprot Entry Name S1PR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000170989
    Target Classification GPCR

    The protein encoded by this gene is structurally similar to G protein-coupled receptors and is highly expressed in endothelial cells. It binds the ligand sphingosine-1-phosphate with high affinity and high specificity, and suggested to be involved in the processes that regulate the differentiation of endothelial cells. Activation of this receptor induces cell-cell adhesion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.