Human CD38/ADPRC 1/ADPRC1 ORF/cDNA clone-Lentivirus plasmid (NM_001775)
Cat. No.: pGMLP002021
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CD38/ADPRC 1/ADPRC1 Lentiviral expression plasmid for CD38 lentivirus packaging, CD38 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CD38/ADPRC 1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002021 |
Gene Name | CD38 |
Accession Number | NM_001775 |
Gene ID | 952 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 903 bp |
Gene Alias | ADPRC 1,ADPRC1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCAACTGCGAGTTCAGCCCGGTGTCCGGGGACAAACCCTGCTGCCGGCTCTCTAGGAGAGCCCAACTCTGTCTTGGCGTCAGTATCCTGGTCCTGATCCTCGTCGTGGTGCTCGCGGTGGTCGTCCCGAGGTGGCGCCAGCAGTGGAGCGGTCCGGGCACCACCAAGCGCTTTCCCGAGACCGTCCTGGCGCGATGCGTCAAGTACACTGAAATTCATCCTGAGATGAGACATGTAGACTGCCAAAGTGTATGGGATGCTTTCAAGGGTGCATTTATTTCAAAACATCCTTGCAACATTACTGAAGAAGACTATCAGCCACTAATGAAGTTGGGAACTCAGACCGTACCTTGCAACAAGATTCTTCTTTGGAGCAGAATAAAAGATCTGGCCCATCAGTTCACACAGGTCCAGCGGGACATGTTCACCCTGGAGGACACGCTGCTAGGCTACCTTGCTGATGACCTCACATGGTGTGGTGAATTCAACACTTCCAAAATAAACTATCAATCTTGCCCAGACTGGAGAAAGGACTGCAGCAACAACCCTGTTTCAGTATTCTGGAAAACGGTTTCCCGCAGGTTTGCAGAAGCTGCCTGTGATGTGGTCCATGTGATGCTCAATGGATCCCGCAGTAAAATCTTTGACAAAAACAGCACTTTTGGGAGTGTGGAAGTCCATAATTTGCAACCAGAGAAGGTTCAGACACTAGAGGCCTGGGTGATACATGGTGGAAGAGAAGATTCCAGAGACTTATGCCAGGATCCCACCATAAAAGAGCTGGAATCGATTATAAGCAAAAGGAATATTCAATTTTCCTGCAAGAATATCTACAGACCTGACAAGTTTCTTCAGTGTGTGAAAAATCCTGAGGATTCATCTTGCACATCTGAGATCTGA |
ORF Protein Sequence | MANCEFSPVSGDKPCCRLSRRAQLCLGVSILVLILVVVLAVVVPRWRQQWSGPGTTKRFPETVLARCVKYTEIHPEMRHVDCQSVWDAFKGAFISKHPCNITEEDYQPLMKLGTQTVPCNKILLWSRIKDLAHQFTQVQRDMFTLEDTLLGYLADDLTWCGEFNTSKINYQSCPDWRKDCSNNPVSVFWKTVSRRFAEAACDVVHVMLNGSRSKIFDKNSTFGSVEVHNLQPEKVQTLEAWVIHGGREDSRDLCQDPTIKELESIISKRNIQFSCKNIYRPDKFLQCVKNPEDSSCTSEI |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T10877 |
Target Name | CD38 |
Gene ID | 952, 12494, 714399, 25668, 101101308, 403756, 327677, 100068959 |
Gene Symbol and Synonyms | ADPRC 1,ADPRC1,cADPR1,CD38,Cd38-rs1,I-19 |
Uniprot Accession | P28907 |
Uniprot Entry Name | CD38_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Cancer |
Gene Ensembl | ENSG00000004468 |
Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
The protein encoded by this gene is a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Crystal structure analysis demonstrates that the functional molecule is a dimer, with the central portion containing the catalytic site. It is used as a prognostic marker for patients with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.