Human CD38/ADPRC 1/ADPRC1 ORF/cDNA clone-Lentivirus particle (NM_001775)

Cat. No.: vGMLP002021

Pre-made Human CD38/ADPRC 1/ADPRC1 Lentiviral expression plasmid for CD38 lentivirus packaging, CD38 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CD38/ADPRC 1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002021 Human CD38 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002021
Gene Name CD38
Accession Number NM_001775
Gene ID 952
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 903 bp
Gene Alias ADPRC 1,ADPRC1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCAACTGCGAGTTCAGCCCGGTGTCCGGGGACAAACCCTGCTGCCGGCTCTCTAGGAGAGCCCAACTCTGTCTTGGCGTCAGTATCCTGGTCCTGATCCTCGTCGTGGTGCTCGCGGTGGTCGTCCCGAGGTGGCGCCAGCAGTGGAGCGGTCCGGGCACCACCAAGCGCTTTCCCGAGACCGTCCTGGCGCGATGCGTCAAGTACACTGAAATTCATCCTGAGATGAGACATGTAGACTGCCAAAGTGTATGGGATGCTTTCAAGGGTGCATTTATTTCAAAACATCCTTGCAACATTACTGAAGAAGACTATCAGCCACTAATGAAGTTGGGAACTCAGACCGTACCTTGCAACAAGATTCTTCTTTGGAGCAGAATAAAAGATCTGGCCCATCAGTTCACACAGGTCCAGCGGGACATGTTCACCCTGGAGGACACGCTGCTAGGCTACCTTGCTGATGACCTCACATGGTGTGGTGAATTCAACACTTCCAAAATAAACTATCAATCTTGCCCAGACTGGAGAAAGGACTGCAGCAACAACCCTGTTTCAGTATTCTGGAAAACGGTTTCCCGCAGGTTTGCAGAAGCTGCCTGTGATGTGGTCCATGTGATGCTCAATGGATCCCGCAGTAAAATCTTTGACAAAAACAGCACTTTTGGGAGTGTGGAAGTCCATAATTTGCAACCAGAGAAGGTTCAGACACTAGAGGCCTGGGTGATACATGGTGGAAGAGAAGATTCCAGAGACTTATGCCAGGATCCCACCATAAAAGAGCTGGAATCGATTATAAGCAAAAGGAATATTCAATTTTCCTGCAAGAATATCTACAGACCTGACAAGTTTCTTCAGTGTGTGAAAAATCCTGAGGATTCATCTTGCACATCTGAGATCTGA
ORF Protein Sequence MANCEFSPVSGDKPCCRLSRRAQLCLGVSILVLILVVVLAVVVPRWRQQWSGPGTTKRFPETVLARCVKYTEIHPEMRHVDCQSVWDAFKGAFISKHPCNITEEDYQPLMKLGTQTVPCNKILLWSRIKDLAHQFTQVQRDMFTLEDTLLGYLADDLTWCGEFNTSKINYQSCPDWRKDCSNNPVSVFWKTVSRRFAEAACDVVHVMLNGSRSKIFDKNSTFGSVEVHNLQPEKVQTLEAWVIHGGREDSRDLCQDPTIKELESIISKRNIQFSCKNIYRPDKFLQCVKNPEDSSCTSEI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-133 Pre-Made Daratumumab biosimilar, Whole mAb, Anti-CD38 Antibody: Anti-ADPRC1/ADPRC 1 therapeutic antibody
    Biosimilar GMP-Bios-ab-279 Pre-Made Isatuximab biosimilar, Whole mAb, Anti-CD38 Antibody: Anti-ADPRC1/ADPRC 1 therapeutic antibody
    Biosimilar GMP-Bios-ab-352 Pre-Made Modakafusp biosimilar, Whole mAb Fusion: Anti-ADPRC therapeutic antibody
    Biosimilar GMP-Bios-ab-208 Pre-Made Felzartamab biosimilar, Whole mAb, Anti-CD38 Antibody: Anti-ADPRC1/ADPRC 1 therapeutic antibody
    Biosimilar GMP-Bios-ab-342 Pre-Made Mezagitamab biosimilar, Whole mAb, Anti-CD38 Antibody: Anti-ADPRC1/ADPRC 1 therapeutic antibody
    Biosimilar GMP-Bios-INN-917 Pre-Made Modakafusp Alfa Biosimilar, Fusion Protein targeting CD38 fused with human IFNA2 (interferon alpha 2) *b (R46,H57) 24-188: Recombinant therapeutic protein targeting ADPRC 1/ADPRC1
    Target Antibody GM-Tg-g-T10877-Ab Anti-CD38/ ADPRC 1/ ADPRC1 monoclonal antibody
    Target Antigen GM-Tg-g-T10877-Ag CD38 VLP (virus-like particle)
    ORF Viral Vector pGMLP002021 Human CD38 Lentivirus plasmid
    ORF Viral Vector vGMLP002021 Human CD38 Lentivirus particle


    Target information

    Target ID GM-T10877
    Target Name CD38
    Gene ID 952, 12494, 714399, 25668, 101101308, 403756, 327677, 100068959
    Gene Symbol and Synonyms ADPRC 1,ADPRC1,cADPR1,CD38,Cd38-rs1,I-19
    Uniprot Accession P28907
    Uniprot Entry Name CD38_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000004468
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Crystal structure analysis demonstrates that the functional molecule is a dimer, with the central portion containing the catalytic site. It is used as a prognostic marker for patients with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.