Human ADORA2B/ADORA2 ORF/cDNA clone-Lentivirus plasmid (NM_000676)
Pre-made Human ADORA2B/ADORA2 Lentiviral expression plasmid for ADORA2B lentivirus packaging, ADORA2B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to ADORA2B/ADORA2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002030 | Human ADORA2B Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002030 |
Gene Name | ADORA2B |
Accession Number | NM_000676 |
Gene ID | 136 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 999 bp |
Gene Alias | ADORA2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGCTGGAGACACAGGACGCGCTGTACGTGGCGCTGGAGCTGGTCATCGCCGCGCTTTCGGTGGCGGGCAACGTGCTGGTGTGCGCCGCGGTGGGCACGGCGAACACTCTGCAGACGCCCACCAACTACTTCCTGGTGTCCCTGGCTGCGGCCGACGTGGCCGTGGGGCTCTTCGCCATCCCCTTTGCCATCACCATCAGCCTGGGCTTCTGCACTGACTTCTACGGCTGCCTCTTCCTCGCCTGCTTCGTGCTGGTGCTCACGCAGAGCTCCATCTTCAGCCTTCTGGCCGTGGCAGTCGACAGATACCTGGCCATCTGTGTCCCGCTCAGGTATAAAAGTTTGGTCACGGGGACCCGAGCAAGAGGGGTCATTGCTGTCCTCTGGGTCCTTGCCTTTGGCATCGGATTGACTCCATTCCTGGGGTGGAACAGTAAAGACAGTGCCACCAACAACTGCACAGAACCCTGGGATGGAACCACGAATGAAAGCTGCTGCCTTGTGAAGTGTCTCTTTGAGAATGTGGTCCCCATGAGCTACATGGTATATTTCAATTTCTTTGGGTGTGTTCTGCCCCCACTGCTTATAATGCTGGTGATCTACATTAAGATCTTCCTGGTGGCCTGCAGGCAGCTTCAGCGCACTGAGCTGATGGACCACTCGAGGACCACCCTCCAGCGGGAGATCCATGCAGCCAAGTCACTGGCCATGATTGTGGGGATTTTTGCCCTGTGCTGGTTACCTGTGCATGCTGTTAACTGTGTCACTCTTTTCCAGCCAGCTCAGGGTAAAAATAAGCCCAAGTGGGCAATGAATATGGCCATTCTTCTGTCACATGCCAATTCAGTTGTCAATCCCATTGTCTATGCTTACCGGAACCGAGACTTCCGCTACACTTTTCACAAAATTATCTCCAGGTATCTTCTCTGCCAAGCAGATGTCAAGAGTGGGAATGGTCAGGCTGGGGTACAGCCTGCTCTCGGTGTGGGCCTATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T86679-Ab | Anti-AA2BR/ ADORA2B/ ADORA2 monoclonal antibody |
Target Antigen | GM-Tg-g-T86679-Ag | ADORA2B VLP (virus-like particle) |
ORF Viral Vector | pGMLP002030 | Human ADORA2B Lentivirus plasmid |
ORF Viral Vector | vGMLP002030 | Human ADORA2B Lentivirus particle |
Target information
Target ID | GM-T86679 |
Target Name | ADORA2B |
Gene ID | 136, 11541, 696848, 29316, 109494208, 403410, 529760, 100063319 |
Gene Symbol and Synonyms | A2b,A2BAR,A2BR,AA2BR,ADORA2,ADORA2B,ARA2B |
Uniprot Accession | P29275 |
Uniprot Entry Name | AA2BR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Not Available |
Gene Ensembl | ENSG00000170425 |
Target Classification | Checkpoint-Immuno Oncology, GPCR |
This gene encodes an adenosine receptor that is a member of the G protein-coupled receptor superfamily. This integral membrane protein stimulates adenylate cyclase activity in the presence of adenosine. This protein also interacts with netrin-1, which is involved in axon elongation. The gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.