Human ADORA2B/ADORA2 ORF/cDNA clone-Lentivirus particle (NM_000676)

Pre-made Human ADORA2B/ADORA2 Lentiviral expression plasmid for ADORA2B lentivirus packaging, ADORA2B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ADORA2B/ADORA2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002030 Human ADORA2B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002030
Gene Name ADORA2B
Accession Number NM_000676
Gene ID 136
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 999 bp
Gene Alias ADORA2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGCTGGAGACACAGGACGCGCTGTACGTGGCGCTGGAGCTGGTCATCGCCGCGCTTTCGGTGGCGGGCAACGTGCTGGTGTGCGCCGCGGTGGGCACGGCGAACACTCTGCAGACGCCCACCAACTACTTCCTGGTGTCCCTGGCTGCGGCCGACGTGGCCGTGGGGCTCTTCGCCATCCCCTTTGCCATCACCATCAGCCTGGGCTTCTGCACTGACTTCTACGGCTGCCTCTTCCTCGCCTGCTTCGTGCTGGTGCTCACGCAGAGCTCCATCTTCAGCCTTCTGGCCGTGGCAGTCGACAGATACCTGGCCATCTGTGTCCCGCTCAGGTATAAAAGTTTGGTCACGGGGACCCGAGCAAGAGGGGTCATTGCTGTCCTCTGGGTCCTTGCCTTTGGCATCGGATTGACTCCATTCCTGGGGTGGAACAGTAAAGACAGTGCCACCAACAACTGCACAGAACCCTGGGATGGAACCACGAATGAAAGCTGCTGCCTTGTGAAGTGTCTCTTTGAGAATGTGGTCCCCATGAGCTACATGGTATATTTCAATTTCTTTGGGTGTGTTCTGCCCCCACTGCTTATAATGCTGGTGATCTACATTAAGATCTTCCTGGTGGCCTGCAGGCAGCTTCAGCGCACTGAGCTGATGGACCACTCGAGGACCACCCTCCAGCGGGAGATCCATGCAGCCAAGTCACTGGCCATGATTGTGGGGATTTTTGCCCTGTGCTGGTTACCTGTGCATGCTGTTAACTGTGTCACTCTTTTCCAGCCAGCTCAGGGTAAAAATAAGCCCAAGTGGGCAATGAATATGGCCATTCTTCTGTCACATGCCAATTCAGTTGTCAATCCCATTGTCTATGCTTACCGGAACCGAGACTTCCGCTACACTTTTCACAAAATTATCTCCAGGTATCTTCTCTGCCAAGCAGATGTCAAGAGTGGGAATGGTCAGGCTGGGGTACAGCCTGCTCTCGGTGTGGGCCTATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T86679-Ab Anti-AA2BR/ ADORA2B/ ADORA2 monoclonal antibody
    Target Antigen GM-Tg-g-T86679-Ag ADORA2B VLP (virus-like particle)
    ORF Viral Vector pGMLP002030 Human ADORA2B Lentivirus plasmid
    ORF Viral Vector vGMLP002030 Human ADORA2B Lentivirus particle


    Target information

    Target ID GM-T86679
    Target Name ADORA2B
    Gene ID 136, 11541, 696848, 29316, 109494208, 403410, 529760, 100063319
    Gene Symbol and Synonyms A2b,A2BAR,A2BR,AA2BR,ADORA2,ADORA2B,ARA2B
    Uniprot Accession P29275
    Uniprot Entry Name AA2BR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000170425
    Target Classification Checkpoint-Immuno Oncology, GPCR

    This gene encodes an adenosine receptor that is a member of the G protein-coupled receptor superfamily. This integral membrane protein stimulates adenylate cyclase activity in the presence of adenosine. This protein also interacts with netrin-1, which is involved in axon elongation. The gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.