Human CTSZ/CTSX ORF/cDNA clone-Lentivirus plasmid (NM_001336)

Pre-made Human CTSZ/CTSX Lentiviral expression plasmid for CTSZ lentivirus packaging, CTSZ lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CTSZ/CTSX products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002070 Human CTSZ Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002070
Gene Name CTSZ
Accession Number NM_001336
Gene ID 1522
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 912 bp
Gene Alias CTSX
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGAGGCGCGGGCCAGGGTGGCGGCCGCTTCTGCTGCTCGTGCTGCTGGCGGGCGCGGCGCAGGGCGGCCTCTACTTCCGCCGGGGACAGACCTGCTACCGGCCTCTGCGGGGGGACGGGCTGGCTCCGCTGGGGCGCAGCACATACCCCCGGCCTCATGAGTACCTGTCCCCAGCGGATCTGCCCAAGAGCTGGGACTGGCGCAATGTGGATGGTGTCAACTATGCCAGCATCACCCGGAACCAGCACATCCCCCAATACTGCGGCTCCTGCTGGGCCCACGCCAGCACCAGCGCTATGGCGGATCGGATCAACATCAAGAGGAAGGGAGCGTGGCCCTCCACCCTCCTGTCCGTGCAGAACGTCATCGACTGCGGTAACGCTGGCTCCTGTGAAGGGGGTAATGACCTGTCCGTGTGGGACTACGCCCACCAGCACGGCATCCCTGACGAGACCTGCAACAACTACCAGGCCAAGGACCAGGAGTGTGACAAGTTTAACCAATGTGGGACATGCAATGAATTCAAAGAGTGCCACGCCATCCGGAACTACACCCTCTGGAGGGTGGGAGACTACGGCTCCCTCTCTGGGAGGGAGAAGATGATGGCAGAAATCTACGCAAATGGTCCCATCAGCTGTGGAATAATGGCAACAGAAAGACTGGCTAACTACACCGGAGGCATCTATGCCGAATACCAGGACACCACATATATAAACCATGTCGTTTCTGTGGCTGGGTGGGGCATCAGTGATGGGACTGAGTACTGGATTGTCCGGAATTCATGGGGTGAACCATGGGGCGAGAGAGGCTGGCTGAGGATCGTGACCAGCACCTATAAGGATGGGAAGGGCGCCAGATACAACCTTGCCATCGAGGAGCACTGTACATTTGGGGACCCCATCGTTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2579-Ab Anti-CATZ/ CTSZ/ CTSX monoclonal antibody
    Target Antigen GM-Tg-g-MP2579-Ag CTSZ VLP (virus-like particle)
    ORF Viral Vector pGMLP002070 Human CTSZ Lentivirus plasmid
    ORF Viral Vector vGMLP002070 Human CTSZ Lentivirus particle


    Target information

    Target ID GM-MP2579
    Target Name CTSZ
    Gene ID 1522, 64138, 694157, 252929, 101087983, 611983, 404187, 100056600
    Gene Symbol and Synonyms CATX,CTSX,CTSZ,D2Wsu143e
    Uniprot Accession Q9UBR2
    Uniprot Entry Name CATZ_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000101160
    Target Classification Not Available

    The protein encoded by this gene is a lysosomal cysteine proteinase and member of the peptidase C1 family. It exhibits both carboxy-monopeptidase and carboxy-dipeptidase activities. The encoded protein has also been known as cathepsin X and cathepsin P. This gene is expressed ubiquitously in cancer cell lines and primary tumors and, like other members of this family, may be involved in tumorigenesis. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.