Human CTSZ/CTSX ORF/cDNA clone-Lentivirus particle (NM_001336)
Pre-made Human CTSZ/CTSX Lentiviral expression plasmid for CTSZ lentivirus packaging, CTSZ lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CTSZ/CTSX products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002070 | Human CTSZ Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002070 |
Gene Name | CTSZ |
Accession Number | NM_001336 |
Gene ID | 1522 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 912 bp |
Gene Alias | CTSX |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGAGGCGCGGGCCAGGGTGGCGGCCGCTTCTGCTGCTCGTGCTGCTGGCGGGCGCGGCGCAGGGCGGCCTCTACTTCCGCCGGGGACAGACCTGCTACCGGCCTCTGCGGGGGGACGGGCTGGCTCCGCTGGGGCGCAGCACATACCCCCGGCCTCATGAGTACCTGTCCCCAGCGGATCTGCCCAAGAGCTGGGACTGGCGCAATGTGGATGGTGTCAACTATGCCAGCATCACCCGGAACCAGCACATCCCCCAATACTGCGGCTCCTGCTGGGCCCACGCCAGCACCAGCGCTATGGCGGATCGGATCAACATCAAGAGGAAGGGAGCGTGGCCCTCCACCCTCCTGTCCGTGCAGAACGTCATCGACTGCGGTAACGCTGGCTCCTGTGAAGGGGGTAATGACCTGTCCGTGTGGGACTACGCCCACCAGCACGGCATCCCTGACGAGACCTGCAACAACTACCAGGCCAAGGACCAGGAGTGTGACAAGTTTAACCAATGTGGGACATGCAATGAATTCAAAGAGTGCCACGCCATCCGGAACTACACCCTCTGGAGGGTGGGAGACTACGGCTCCCTCTCTGGGAGGGAGAAGATGATGGCAGAAATCTACGCAAATGGTCCCATCAGCTGTGGAATAATGGCAACAGAAAGACTGGCTAACTACACCGGAGGCATCTATGCCGAATACCAGGACACCACATATATAAACCATGTCGTTTCTGTGGCTGGGTGGGGCATCAGTGATGGGACTGAGTACTGGATTGTCCGGAATTCATGGGGTGAACCATGGGGCGAGAGAGGCTGGCTGAGGATCGTGACCAGCACCTATAAGGATGGGAAGGGCGCCAGATACAACCTTGCCATCGAGGAGCACTGTACATTTGGGGACCCCATCGTTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2579-Ab | Anti-CATZ/ CTSZ/ CTSX monoclonal antibody |
Target Antigen | GM-Tg-g-MP2579-Ag | CTSZ VLP (virus-like particle) |
ORF Viral Vector | pGMLP002070 | Human CTSZ Lentivirus plasmid |
ORF Viral Vector | vGMLP002070 | Human CTSZ Lentivirus particle |
Target information
Target ID | GM-MP2579 |
Target Name | CTSZ |
Gene ID | 1522, 64138, 694157, 252929, 101087983, 611983, 404187, 100056600 |
Gene Symbol and Synonyms | CATX,CTSX,CTSZ,D2Wsu143e |
Uniprot Accession | Q9UBR2 |
Uniprot Entry Name | CATZ_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000101160 |
Target Classification | Not Available |
The protein encoded by this gene is a lysosomal cysteine proteinase and member of the peptidase C1 family. It exhibits both carboxy-monopeptidase and carboxy-dipeptidase activities. The encoded protein has also been known as cathepsin X and cathepsin P. This gene is expressed ubiquitously in cancer cell lines and primary tumors and, like other members of this family, may be involved in tumorigenesis. [provided by RefSeq, Oct 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.