Human HTR2A/5-HT2A/ HTR2 ORF/cDNA clone-Lentivirus plasmid (NM_000621)
Pre-made Human HTR2A/5-HT2A/ HTR2 Lentiviral expression plasmid for HTR2A lentivirus packaging, HTR2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to HTR2A/5-HT2A products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002120 | Human HTR2A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002120 |
Gene Name | HTR2A |
Accession Number | NM_000621 |
Gene ID | 3356 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1416 bp |
Gene Alias | 5-HT2A, HTR2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATATTCTTTGTGAAGAAAATACTTCTTTGAGCTCAACTACGAACTCCCTAATGCAATTAAATGATGACACCAGGCTCTACAGTAATGACTTTAACTCCGGAGAAGCTAACACTTCTGATGCATTTAACTGGACAGTCGACTCTGAAAATCGAACCAACCTTTCCTGTGAAGGGTGCCTCTCACCGTCGTGTCTCTCCTTACTTCATCTCCAGGAAAAAAACTGGTCTGCTTTACTGACAGCCGTAGTGATTATTCTAACTATTGCTGGAAACATACTCGTCATCATGGCAGTGTCCCTAGAGAAAAAGCTGCAGAATGCCACCAACTATTTCCTGATGTCACTTGCCATAGCTGATATGCTGCTGGGTTTCCTTGTCATGCCCGTGTCCATGTTAACCATCCTGTATGGGTACCGGTGGCCTCTGCCGAGCAAGCTTTGTGCAGTCTGGATTTACCTGGACGTGCTCTTCTCCACGGCCTCCATCATGCACCTCTGCGCCATCTCGCTGGACCGCTACGTCGCCATCCAGAATCCCATCCACCACAGCCGCTTCAACTCCAGAACTAAGGCATTTCTGAAAATCATTGCTGTTTGGACCATATCAGTAGGTATATCCATGCCAATACCAGTCTTTGGGCTACAGGACGATTCGAAGGTCTTTAAGGAGGGGAGTTGCTTACTCGCCGATGATAACTTTGTCCTGATCGGCTCTTTTGTGTCATTTTTCATTCCCTTAACCATCATGGTGATCACCTACTTTCTAACTATCAAGTCACTCCAGAAAGAAGCTACTTTGTGTGTAAGTGATCTTGGCACACGGGCCAAATTAGCTTCTTTCAGCTTCCTCCCTCAGAGTTCTTTGTCTTCAGAAAAGCTCTTCCAGCGGTCGATCCATAGGGAGCCAGGGTCCTACACAGGCAGGAGGACTATGCAGTCCATCAGCAATGAGCAAAAGGCATGCAAGGTGCTGGGCATCGTCTTCTTCCTGTTTGTGGTGATGTGGTGCCCTTTCTTCATCACAAACATCATGGCCGTCATCTGCAAAGAGTCCTGCAATGAGGATGTCATTGGGGCCCTGCTCAATGTGTTTGTTTGGATCGGTTATCTCTCTTCAGCAGTCAACCCACTAGTCTACACACTGTTCAACAAGACCTATAGGTCAGCCTTTTCACGGTATATTCAGTGTCAGTACAAGGAAAACAAAAAACCATTGCAGTTAATTTTAGTGAACACAATACCGGCTTTGGCCTACAAGTCTAGCCAACTTCAAATGGGACAAAAAAAGAATTCAAAGCAAGATGCCAAGACAACAGATAATGACTGCTCAATGGTTGCTCTAGGAAAGCAGCATTCTGAAGAGGCTTCTAAAGACAATAGCGACGGAGTGAATGAAAAGGTGAGCTGTGTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T32060-Ab | Anti-5HT2A/ HTR2A/ 5-HT2A monoclonal antibody |
Target Antigen | GM-Tg-g-T32060-Ag | HTR2A VLP (virus-like particle) |
ORF Viral Vector | pGMLP002120 | Human HTR2A Lentivirus plasmid |
ORF Viral Vector | pGMAP000503 | |
ORF Viral Vector | vGMLP002120 | Human HTR2A Lentivirus particle |
ORF Viral Vector | vGMAP000503 | Human HTR2A Adenovirus particle |
Target information
Target ID | GM-T32060 |
Target Name | HTR2A |
Gene ID | 3356, 15558, 613032, 29595, 101081108, 403882, 407230, 100009685 |
Gene Symbol and Synonyms | 5-HT-2,5-HT-2A,5-HT2A,5-HTR2A,5Ht-2,5HT2A,5HTR2A,E030013E04,Htr-2,HTR2,HTR2A |
Uniprot Accession | P28223 |
Uniprot Entry Name | 5HT2A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Schizophrenia |
Gene Ensembl | ENSG00000102468 |
Target Classification | GPCR |
This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.