Human HTR2A/5-HT2A/ HTR2 ORF/cDNA clone-Lentivirus plasmid (NM_000621)

Pre-made Human HTR2A/5-HT2A/ HTR2 Lentiviral expression plasmid for HTR2A lentivirus packaging, HTR2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to HTR2A/5-HT2A products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002120 Human HTR2A Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002120
Gene Name HTR2A
Accession Number NM_000621
Gene ID 3356
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1416 bp
Gene Alias 5-HT2A, HTR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATATTCTTTGTGAAGAAAATACTTCTTTGAGCTCAACTACGAACTCCCTAATGCAATTAAATGATGACACCAGGCTCTACAGTAATGACTTTAACTCCGGAGAAGCTAACACTTCTGATGCATTTAACTGGACAGTCGACTCTGAAAATCGAACCAACCTTTCCTGTGAAGGGTGCCTCTCACCGTCGTGTCTCTCCTTACTTCATCTCCAGGAAAAAAACTGGTCTGCTTTACTGACAGCCGTAGTGATTATTCTAACTATTGCTGGAAACATACTCGTCATCATGGCAGTGTCCCTAGAGAAAAAGCTGCAGAATGCCACCAACTATTTCCTGATGTCACTTGCCATAGCTGATATGCTGCTGGGTTTCCTTGTCATGCCCGTGTCCATGTTAACCATCCTGTATGGGTACCGGTGGCCTCTGCCGAGCAAGCTTTGTGCAGTCTGGATTTACCTGGACGTGCTCTTCTCCACGGCCTCCATCATGCACCTCTGCGCCATCTCGCTGGACCGCTACGTCGCCATCCAGAATCCCATCCACCACAGCCGCTTCAACTCCAGAACTAAGGCATTTCTGAAAATCATTGCTGTTTGGACCATATCAGTAGGTATATCCATGCCAATACCAGTCTTTGGGCTACAGGACGATTCGAAGGTCTTTAAGGAGGGGAGTTGCTTACTCGCCGATGATAACTTTGTCCTGATCGGCTCTTTTGTGTCATTTTTCATTCCCTTAACCATCATGGTGATCACCTACTTTCTAACTATCAAGTCACTCCAGAAAGAAGCTACTTTGTGTGTAAGTGATCTTGGCACACGGGCCAAATTAGCTTCTTTCAGCTTCCTCCCTCAGAGTTCTTTGTCTTCAGAAAAGCTCTTCCAGCGGTCGATCCATAGGGAGCCAGGGTCCTACACAGGCAGGAGGACTATGCAGTCCATCAGCAATGAGCAAAAGGCATGCAAGGTGCTGGGCATCGTCTTCTTCCTGTTTGTGGTGATGTGGTGCCCTTTCTTCATCACAAACATCATGGCCGTCATCTGCAAAGAGTCCTGCAATGAGGATGTCATTGGGGCCCTGCTCAATGTGTTTGTTTGGATCGGTTATCTCTCTTCAGCAGTCAACCCACTAGTCTACACACTGTTCAACAAGACCTATAGGTCAGCCTTTTCACGGTATATTCAGTGTCAGTACAAGGAAAACAAAAAACCATTGCAGTTAATTTTAGTGAACACAATACCGGCTTTGGCCTACAAGTCTAGCCAACTTCAAATGGGACAAAAAAAGAATTCAAAGCAAGATGCCAAGACAACAGATAATGACTGCTCAATGGTTGCTCTAGGAAAGCAGCATTCTGAAGAGGCTTCTAAAGACAATAGCGACGGAGTGAATGAAAAGGTGAGCTGTGTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32060-Ab Anti-5HT2A/ HTR2A/ 5-HT2A monoclonal antibody
    Target Antigen GM-Tg-g-T32060-Ag HTR2A VLP (virus-like particle)
    ORF Viral Vector pGMLP002120 Human HTR2A Lentivirus plasmid
    ORF Viral Vector pGMAP000503
    ORF Viral Vector vGMLP002120 Human HTR2A Lentivirus particle
    ORF Viral Vector vGMAP000503 Human HTR2A Adenovirus particle


    Target information

    Target ID GM-T32060
    Target Name HTR2A
    Gene ID 3356, 15558, 613032, 29595, 101081108, 403882, 407230, 100009685
    Gene Symbol and Synonyms 5-HT-2,5-HT-2A,5-HT2A,5-HTR2A,5Ht-2,5HT2A,5HTR2A,E030013E04,Htr-2,HTR2,HTR2A
    Uniprot Accession P28223
    Uniprot Entry Name 5HT2A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Schizophrenia
    Gene Ensembl ENSG00000102468
    Target Classification GPCR

    This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.