Human TNFSF13B/BAFF/ BLYS ORF/cDNA clone-Lentivirus plasmid (NM_006573)

Pre-made Human TNFSF13B/BAFF/ BLYS Lentiviral expression plasmid for TNFSF13B lentivirus packaging, TNFSF13B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TNFSF13B/BAFF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002206 Human TNFSF13B Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002206
Gene Name TNFSF13B
Accession Number NM_006573
Gene ID 10673
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 858 bp
Gene Alias BAFF, BLYS, CD257, DTL, TALL-1, TALL1, THANK, TNFSF20, TNLG7A, ZTNF4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATGACTCCACAGAAAGGGAGCAGTCACGCCTTACTTCTTGCCTTAAGAAAAGAGAAGAAATGAAACTGAAGGAGTGTGTTTCCATCCTCCCACGGAAGGAAAGCCCCTCTGTCCGATCCTCCAAAGACGGAAAGCTGCTGGCTGCAACCTTGCTGCTGGCACTGCTGTCTTGCTGCCTCACGGTGGTGTCTTTCTACCAGGTGGCCGCCCTGCAAGGGGACCTGGCCAGCCTCCGGGCAGAGCTGCAGGGCCACCACGCGGAGAAGCTGCCAGCAGGAGCAGGAGCCCCCAAGGCCGGCCTGGAGGAAGCTCCAGCTGTCACCGCGGGACTGAAAATCTTTGAACCACCAGCTCCAGGAGAAGGCAACTCCAGTCAGAACAGCAGAAATAAGCGTGCCGTTCAGGGTCCAGAAGAAACAGTCACTCAAGACTGCTTGCAACTGATTGCAGACAGTGAAACACCAACTATACAAAAAGGATCTTACACATTTGTTCCATGGCTTCTCAGCTTTAAAAGGGGAAGTGCCCTAGAAGAAAAAGAGAATAAAATATTGGTCAAAGAAACTGGTTACTTTTTTATATATGGTCAGGTTTTATATACTGATAAGACCTACGCCATGGGACATCTAATTCAGAGGAAGAAGGTCCATGTCTTTGGGGATGAATTGAGTCTGGTGACTTTGTTTCGATGTATTCAAAATATGCCTGAAACACTACCCAATAATTCCTGCTATTCAGCTGGCATTGCAAAACTGGAAGAAGGAGATGAACTCCAACTTGCAATACCAAGAGAAAATGCACAAATATCACTGGATGGAGATGTCACATTTTTTGGTGCATTGAAACTGCTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-1018 Pre-Made Telitacicept Biosimilar, Fusion Protein targeting TNFSF13B fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting BAFF/BLYS/CD257/DTL/TALL-1/TALL1/THANK/TNFSF20/TNLG7A/ZTNF4
    Biosimilar GMP-Bios-ab-540 Pre-Made Tabalumab biosimilar, Whole mAb, Anti-TNFSF13B Antibody: Anti-BAFF/BLYS/CD257/DTL/TALL-1/TALL1/THANK/TNFSF20/TNLG7A/ZTNF4 therapeutic antibody
    Biosimilar GMP-Bios-INN-767 Pre-Made Briobacept Biosimilar, Fusion Protein targeting TNFSF13B fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting BAFF/BLYS/CD257/DTL/TALL-1/TALL1/THANK/TNFSF20/TNLG7A/ZTNF4
    Biosimilar GMP-Bios-ab-056 Pre-Made Belimumab biosimilar, Whole mAb, Anti-TNFSF13B Antibody: Anti-BAFF/BLYS/CD257/DTL/TALL-1/TALL1/THANK/TNFSF20/TNLG7A/ZTNF4 therapeutic antibody
    Biosimilar GMP-Bios-ab-568 Pre-Made Tibulizumab biosimilar, Bispecific Mixed mAb and scFv, Anti-TNFSF13B;IL17A/IL17 Antibody: Anti-BAFF/BLYS/CD257/DTL/TALL-1/TALL1/THANK/TNFSF20/TNLG7A/ZTNF4;CTLA-8/CTLA8A therapeutic antibody
    Biosimilar GMP-Bios-INN-764 Pre-Made Blisibimod Biosimilar, Fusion Protein targeting TNFSF13B fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting BAFF/BLYS/CD257/DTL/TALL-1/TALL1/THANK/TNFSF20/TNLG7A/ZTNF4
    Target Antibody GM-Tg-g-T02318-Ab Anti-TN13B/ TNFSF13B/ BAFF monoclonal antibody
    Target Antigen GM-Tg-g-T02318-Ag TNFSF13B VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T02318 tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B) protein & antibody
    ORF Viral Vector pGMLP002206 Human TNFSF13B Lentivirus plasmid
    ORF Viral Vector vGMLP002206 Human TNFSF13B Lentivirus particle


    Target information

    Target ID GM-T02318
    Target Name TNFSF13B
    Gene ID 10673, 24099, 693917, 498666, 101088640, 485545, 504507, 100051550
    Gene Symbol and Synonyms BAFF,BLYS,CD257,D8Ertd387e,DTL,RGD1561519,TALL-1,TALL1,THANK,TNFSF13B,TNFSF20,TNLG7A,ZTNF4
    Uniprot Accession Q9Y275
    Uniprot Entry Name TN13B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Lupus Glomerulonephritis
    Gene Ensembl ENSG00000102524
    Target Classification Not Available

    The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptors TNFRSF13B/TACI, TNFRSF17/BCMA, and TNFRSF13C/BAFFR. This cytokine is expressed in B cell lineage cells, and acts as a potent B cell activator. It has been also shown to play an important role in the proliferation and differentiation of B cells. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.