Human SERPINA7/TBG/ TBGQTL ORF/cDNA clone-Lentivirus plasmid (NM_000354)
Pre-made Human SERPINA7/TBG/ TBGQTL Lentiviral expression plasmid for SERPINA7 lentivirus packaging, SERPINA7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SERPINA7/TBG products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002278 | Human SERPINA7 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002278 |
Gene Name | SERPINA7 |
Accession Number | NM_000354 |
Gene ID | 6906 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1248 bp |
Gene Alias | TBG, TBGQTL |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCACCATTCCTGTATCTGGTTCTCTTGGTACTTGGGCTTCATGCTACAATCCACTGTGCATCACCTGAAGGCAAAGTAACAGCCTGCCATTCATCCCAACCAAATGCCACTCTCTACAAGATGTCATCCATTAATGCTGACTTTGCATTCAATCTGTACCGGAGGTTCACTGTGGAGACCCCAGATAAGAACATCTTCTTTTCCCCTGTGAGCATTTCTGCAGCTTTGGTTATGCTTTCCTTTGGGGCCTGCTGCAGCACCCAAACTGAGATTGTGGAGACCTTGGGGTTCAACCTCACAGACACTCCAATGGTAGAGATCCAGCATGGCTTCCAGCATCTGATCTGTTCACTGAATTTTCCAAAGAAGGAACTGGAATTGCAGATAGGAAATGCCCTCTTCATTGGCAAGCATCTGAAACCACTGGCAAAGTTCTTGAATGATGTCAAGACCCTCTATGAGACTGAAGTCTTTTCTACCGACTTCTCCAACATTTCTGCAGCCAAGCAGGAGATTAACAGTCATGTGGAGATGCAAACCAAAGGGAAAGTTGTGGGTCTAATTCAAGACCTCAAGCCAAACACCATCATGGTCTTAGTGAACTATATTCACTTTAAAGCCCAGTGGGCAAATCCTTTTGATCCATCCAAGACAGAAGACAGTTCCAGCTTCTTAATAGACAAGACCACCACTGTTCAAGTGCCCATGATGCACCAGATGGAACAATACTATCACCTAGTGGATATGGAATTGAACTGCACAGTTCTGCAAATGGACTACAGCAAGAATGCTCTGGCACTCTTTGTTCTTCCCAAGGAGGGACAGATGGAGTCAGTGGAAGCTGCCATGTCATCTAAAACACTGAAGAAGTGGAACCGCTTACTACAGAAGGGATGGGTTGACTTGTTTGTTCCAAAGTTTTCCATTTCTGCCACATATGACCTTGGAGCCACACTTTTGAAGATGGGCATTCAGCATGCCTATTCTGAAAATGCTGATTTTTCTGGACTCACAGAGGACAATGGTCTGAAACTTTCCAATGCTGCCCATAAGGCTGTGCTGCACATTGGTGAAAAGGGAACTGAAGCTGCAGCTGTCCCTGAAGTTGAACTTTCGGATCAGCCTGAAAACACTTTCCTACACCCTATTATCCAAATTGATAGATCTTTCATGTTGTTGATTTTGGAGAGAAGCACAAGGAGTATTCTCTTTCTAGGGAAAGTTGTGAACCCAACGGAAGCGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1279-Ab | Anti-THBG/ SERPINA7/ TBG functional antibody |
Target Antigen | GM-Tg-g-SE1279-Ag | SERPINA7 protein |
ORF Viral Vector | pGMLP002278 | Human SERPINA7 Lentivirus plasmid |
ORF Viral Vector | vGMLP002278 | Human SERPINA7 Lentivirus particle |
Target information
Target ID | GM-SE1279 |
Target Name | SERPINA7 |
Gene ID | 6906, 331535, 700439, 81806, 101100545, 481007, 282518, 100061538 |
Gene Symbol and Synonyms | C730040N12Rik,SERPINA7,TBG,TBGQTL |
Uniprot Accession | P05543 |
Uniprot Entry Name | THBG_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Diagnostics Biomarker |
Disease | Not Available |
Gene Ensembl | ENSG00000123561 |
Target Classification | Not Available |
There are three proteins including thyroxine-binding globulin (TBG), transthyretin and albumin responsible for carrying the thyroid hormones thyroxine (T4) and 3,5,3'-triiodothyronine (T3) in the bloodstream. This gene encodes the major thyroid hormone transport protein, TBG, in serum. It belongs to the serpin family in genomics, but the protein has no inhibitory function like many other members of the serpin family. Mutations in this gene result in TGB deficiency, which has been classified as partial deficiency, complete deficiency, and excess, based on the level of serum TBG. Alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of these variants has not been determined.[provided by RefSeq, Jun 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.