Human SERPINA7/TBG/TBGQTL ORF/cDNA clone-Lentivirus particle (NM_000354)

Cat. No.: vGMLP002278

Pre-made Human SERPINA7/TBG/TBGQTL Lentiviral expression plasmid for SERPINA7 lentivirus packaging, SERPINA7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SERPINA7/TBG products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002278 Human SERPINA7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002278
Gene Name SERPINA7
Accession Number NM_000354
Gene ID 6906
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1248 bp
Gene Alias TBG,TBGQTL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCACCATTCCTGTATCTGGTTCTCTTGGTACTTGGGCTTCATGCTACAATCCACTGTGCATCACCTGAAGGCAAAGTAACAGCCTGCCATTCATCCCAACCAAATGCCACTCTCTACAAGATGTCATCCATTAATGCTGACTTTGCATTCAATCTGTACCGGAGGTTCACTGTGGAGACCCCAGATAAGAACATCTTCTTTTCCCCTGTGAGCATTTCTGCAGCTTTGGTTATGCTTTCCTTTGGGGCCTGCTGCAGCACCCAAACTGAGATTGTGGAGACCTTGGGGTTCAACCTCACAGACACTCCAATGGTAGAGATCCAGCATGGCTTCCAGCATCTGATCTGTTCACTGAATTTTCCAAAGAAGGAACTGGAATTGCAGATAGGAAATGCCCTCTTCATTGGCAAGCATCTGAAACCACTGGCAAAGTTCTTGAATGATGTCAAGACCCTCTATGAGACTGAAGTCTTTTCTACCGACTTCTCCAACATTTCTGCAGCCAAGCAGGAGATTAACAGTCATGTGGAGATGCAAACCAAAGGGAAAGTTGTGGGTCTAATTCAAGACCTCAAGCCAAACACCATCATGGTCTTAGTGAACTATATTCACTTTAAAGCCCAGTGGGCAAATCCTTTTGATCCATCCAAGACAGAAGACAGTTCCAGCTTCTTAATAGACAAGACCACCACTGTTCAAGTGCCCATGATGCACCAGATGGAACAATACTATCACCTAGTGGATATGGAATTGAACTGCACAGTTCTGCAAATGGACTACAGCAAGAATGCTCTGGCACTCTTTGTTCTTCCCAAGGAGGGACAGATGGAGTCAGTGGAAGCTGCCATGTCATCTAAAACACTGAAGAAGTGGAACCGCTTACTACAGAAGGGATGGGTTGACTTGTTTGTTCCAAAGTTTTCCATTTCTGCCACATATGACCTTGGAGCCACACTTTTGAAGATGGGCATTCAGCATGCCTATTCTGAAAATGCTGATTTTTCTGGACTCACAGAGGACAATGGTCTGAAACTTTCCAATGCTGCCCATAAGGCTGTGCTGCACATTGGTGAAAAGGGAACTGAAGCTGCAGCTGTCCCTGAAGTTGAACTTTCGGATCAGCCTGAAAACACTTTCCTACACCCTATTATCCAAATTGATAGATCTTTCATGTTGTTGATTTTGGAGAGAAGCACAAGGAGTATTCTCTTTCTAGGGAAAGTTGTGAACCCAACGGAAGCGTAG
ORF Protein Sequence MSPFLYLVLLVLGLHATIHCASPEGKVTACHSSQPNATLYKMSSINADFAFNLYRRFTVETPDKNIFFSPVSISAALVMLSFGACCSTQTEIVETLGFNLTDTPMVEIQHGFQHLICSLNFPKKELELQIGNALFIGKHLKPLAKFLNDVKTLYETEVFSTDFSNISAAKQEINSHVEMQTKGKVVGLIQDLKPNTIMVLVNYIHFKAQWANPFDPSKTEDSSSFLIDKTTTVQVPMMHQMEQYYHLVDMELNCTVLQMDYSKNALALFVLPKEGQMESVEAAMSSKTLKKWNRLLQKGWVDLFVPKFSISATYDLGATLLKMGIQHAYSENADFSGLTEDNGLKLSNAAHKAVLHIGEKGTEAAAVPEVELSDQPENTFLHPIIQIDRSFMLLILERSTRSILFLGKVVNPTEA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1279-Ab Anti-THBG/ SERPINA7/ TBG functional antibody
    Target Antigen GM-Tg-g-SE1279-Ag SERPINA7 protein
    ORF Viral Vector pGMLP002278 Human SERPINA7 Lentivirus plasmid
    ORF Viral Vector vGMLP002278 Human SERPINA7 Lentivirus particle


    Target information

    Target ID GM-SE1279
    Target Name SERPINA7
    Gene ID 6906, 331535, 700439, 81806, 101100545, 481007, 282518, 100061538
    Gene Symbol and Synonyms C730040N12Rik,SERPINA7,TBG,TBGQTL
    Uniprot Accession P05543
    Uniprot Entry Name THBG_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000123561
    Target Classification Not Available

    There are three proteins including thyroxine-binding globulin (TBG), transthyretin and albumin responsible for carrying the thyroid hormones thyroxine (T4) and 3,5,3'-triiodothyronine (T3) in the bloodstream. This gene encodes the major thyroid hormone transport protein, TBG, in serum. It belongs to the serpin family in genomics, but the protein has no inhibitory function like many other members of the serpin family. Mutations in this gene result in TGB deficiency, which has been classified as partial deficiency, complete deficiency, and excess, based on the level of serum TBG. Alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of these variants has not been determined.[provided by RefSeq, Jun 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.