Human SNAP23/HsT17016/SNAP-23 ORF/cDNA clone-Lentivirus plasmid (NM_003825)

Cat. No.: pGMLP002382
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SNAP23/HsT17016/SNAP-23 Lentiviral expression plasmid for SNAP23 lentivirus packaging, SNAP23 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to SNAP23/HsT17016 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $459
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002382
Gene Name SNAP23
Accession Number NM_003825
Gene ID 8773
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 636 bp
Gene Alias HsT17016,SNAP-23,SNAP23A,SNAP23B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATAATCTGTCATCAGAAGAAATTCAACAGAGAGCTCACCAGATTACTGATGAGTCTCTGGAAAGTACGAGGAGAATCCTGGGTTTAGCCATTGAGTCTCAGGATGCAGGAATCAAGACCATCACTATGCTGGATGAACAAAAGGAACAACTAAACCGCATAGAAGAAGGCTTGGACCAAATAAATAAGGACATGAGAGAGACAGAGAAGACTTTAACAGAACTCAACAAATGCTGTGGCCTTTGTGTCTGCCCATGTAATAGAACAAAGAACTTTGAGTCTGGCAAGGCTTATAAGACAACATGGGGAGATGGTGGAGAAAACTCACCTTGCAATGTAGTATCTAAACAGCCAGGCCCGGTGACAAATGGTCAGCTTCAGCAACCAACAACGGGAGCAGCCAGTGGTGGATACATTAAACGCATAACTAATGATGCCAGAGAAGATGAAATGGAAGAGAACCTGACTCAAGTGGGCAGTATCCTGGGAAATCTAAAAGACATGGCCCTGAACATAGGCAATGAGATTGATGCTCAAAATCCACAAATAAAACGAATCACAGACAAGGCTGACACCAACAGAGATCGTATTGATATTGCCAATGCCAGAGCAAAGAAACTCATTGACAGCTAA
ORF Protein Sequence MDNLSSEEIQQRAHQITDESLESTRRILGLAIESQDAGIKTITMLDEQKEQLNRIEEGLDQINKDMRETEKTLTELNKCCGLCVCPCNRTKNFESGKAYKTTWGDGGENSPCNVVSKQPGPVTNGQLQQPTTGAASGGYIKRITNDAREDEMEENLTQVGSILGNLKDMALNIGNEIDAQNPQIKRITDKADTNRDRIDIANARAKKLIDS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2332-Ab Anti-SNP23/ SNAP23/ HsT17016 monoclonal antibody
    Target Antigen GM-Tg-g-MP2332-Ag SNAP23 VLP (virus-like particle)
    ORF Viral Vector pGMLP002382 Human SNAP23 Lentivirus plasmid
    ORF Viral Vector vGMLP002382 Human SNAP23 Lentivirus particle


    Target information

    Target ID GM-MP2332
    Target Name SNAP23
    Gene ID 8773, 20619, 708225, 64630, 101101473, 478268, 522423, 100056719
    Gene Symbol and Synonyms 23kDa,HsT17016,SNAP-23,SNAP23,SNAP23A,SNAP23B,Sndt,Syndet
    Uniprot Accession O00161
    Uniprot Entry Name SNP23_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000092531
    Target Classification Not Available

    Specificity of vesicular transport is regulated, in part, by the interaction of a vesicle-associated membrane protein termed synaptobrevin/VAMP with a target compartment membrane protein termed syntaxin. These proteins, together with SNAP25 (synaptosome-associated protein of 25 kDa), form a complex which serves as a binding site for the general membrane fusion machinery. Synaptobrevin/VAMP and syntaxin are believed to be involved in vesicular transport in most, if not all cells, while SNAP25 is present almost exclusively in the brain, suggesting that a ubiquitously expressed homolog of SNAP25 exists to facilitate transport vesicle/target membrane fusion in other tissues. The protein encoded by this gene is structurally and functionally similar to SNAP25 and binds tightly to multiple syntaxins and synaptobrevins/VAMPs. It is an essential component of the high affinity receptor for the general membrane fusion machinery and is an important regulator of transport vesicle docking and fusion. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.