Human SNAP23/HsT17016/SNAP-23 ORF/cDNA clone-Lentivirus particle (NM_003825)
Cat. No.: vGMLP002382
Pre-made Human SNAP23/HsT17016/SNAP-23 Lentiviral expression plasmid for SNAP23 lentivirus packaging, SNAP23 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
SNAP23/HsT17016 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP002382 | Human SNAP23 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP002382 |
| Gene Name | SNAP23 |
| Accession Number | NM_003825 |
| Gene ID | 8773 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 636 bp |
| Gene Alias | HsT17016,SNAP-23,SNAP23A,SNAP23B |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGATAATCTGTCATCAGAAGAAATTCAACAGAGAGCTCACCAGATTACTGATGAGTCTCTGGAAAGTACGAGGAGAATCCTGGGTTTAGCCATTGAGTCTCAGGATGCAGGAATCAAGACCATCACTATGCTGGATGAACAAAAGGAACAACTAAACCGCATAGAAGAAGGCTTGGACCAAATAAATAAGGACATGAGAGAGACAGAGAAGACTTTAACAGAACTCAACAAATGCTGTGGCCTTTGTGTCTGCCCATGTAATAGAACAAAGAACTTTGAGTCTGGCAAGGCTTATAAGACAACATGGGGAGATGGTGGAGAAAACTCACCTTGCAATGTAGTATCTAAACAGCCAGGCCCGGTGACAAATGGTCAGCTTCAGCAACCAACAACGGGAGCAGCCAGTGGTGGATACATTAAACGCATAACTAATGATGCCAGAGAAGATGAAATGGAAGAGAACCTGACTCAAGTGGGCAGTATCCTGGGAAATCTAAAAGACATGGCCCTGAACATAGGCAATGAGATTGATGCTCAAAATCCACAAATAAAACGAATCACAGACAAGGCTGACACCAACAGAGATCGTATTGATATTGCCAATGCCAGAGCAAAGAAACTCATTGACAGCTAA |
| ORF Protein Sequence | MDNLSSEEIQQRAHQITDESLESTRRILGLAIESQDAGIKTITMLDEQKEQLNRIEEGLDQINKDMRETEKTLTELNKCCGLCVCPCNRTKNFESGKAYKTTWGDGGENSPCNVVSKQPGPVTNGQLQQPTTGAASGGYIKRITNDAREDEMEENLTQVGSILGNLKDMALNIGNEIDAQNPQIKRITDKADTNRDRIDIANARAKKLIDS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP2332-Ab | Anti-SNP23/ SNAP23/ HsT17016 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP2332-Ag | SNAP23 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP002382 | Human SNAP23 Lentivirus plasmid |
| ORF Viral Vector | vGMLP002382 | Human SNAP23 Lentivirus particle |
Target information
| Target ID | GM-MP2332 |
| Target Name | SNAP23 |
| Gene ID | 8773, 20619, 708225, 64630, 101101473, 478268, 522423, 100056719 |
| Gene Symbol and Synonyms | 23kDa,HsT17016,SNAP-23,SNAP23,SNAP23A,SNAP23B,Sndt,Syndet |
| Uniprot Accession | O00161 |
| Uniprot Entry Name | SNP23_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000092531 |
| Target Classification | Not Available |
Specificity of vesicular transport is regulated, in part, by the interaction of a vesicle-associated membrane protein termed synaptobrevin/VAMP with a target compartment membrane protein termed syntaxin. These proteins, together with SNAP25 (synaptosome-associated protein of 25 kDa), form a complex which serves as a binding site for the general membrane fusion machinery. Synaptobrevin/VAMP and syntaxin are believed to be involved in vesicular transport in most, if not all cells, while SNAP25 is present almost exclusively in the brain, suggesting that a ubiquitously expressed homolog of SNAP25 exists to facilitate transport vesicle/target membrane fusion in other tissues. The protein encoded by this gene is structurally and functionally similar to SNAP25 and binds tightly to multiple syntaxins and synaptobrevins/VAMPs. It is an essential component of the high affinity receptor for the general membrane fusion machinery and is an important regulator of transport vesicle docking and fusion. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


