Human GOT2/KAT4/ KATIV ORF/cDNA clone-Lentivirus plasmid (NM_002080)

Pre-made Human GOT2/KAT4/ KATIV Lentiviral expression plasmid for GOT2 lentivirus packaging, GOT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GOT2/KAT4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002404 Human GOT2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002404
Gene Name GOT2
Accession Number NM_002080
Gene ID 2806
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1293 bp
Gene Alias KAT4, KATIV, KYAT4, mitAAT
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCCTGCTGCACTCCGGCCGCGTCCTCCCCGGGATCGCCGCCGCCTTCCACCCGGGCCTCGCCGCCGCGGCCTCTGCCAGAGCCAGCTCCTGGTGGACCCATGTGGAAATGGGACCTCCAGATCCCATTCTGGGAGTCACTGAAGCCTTTAAGAGGGACACCAATAGCAAAAAGATGAATCTGGGAGTTGGTGCCTACCGGGATGATAATGGAAAGCCTTACGTTCTGCCTAGCGTCCGCAAGGCAGAGGCCCAGATTGCCGCAAAAAATTTGGACAAGGAATACCTGCCCATTGGGGGACTGGCTGAATTTTGCAAGGCATCTGCAGAACTAGCCCTGGGTGAGAACAGCGAAGTCTTGAAGAGTGGCCGGTTTGTCACTGTGCAGACCATTTCTGGAACTGGAGCCTTAAGGATCGGAGCCAGTTTTCTGCAAAGATTTTTTAAGTTCAGCCGAGATGTCTTTCTGCCCAAACCAACCTGGGGAAACCACACACCCATCTTCAGGGATGCTGGCATGCAGCTACAAGGTTATCGGTATTATGACCCCAAGACTTGCGGTTTTGACTTCACAGGCGCTGTGGAGGATATTTCAAAAATACCAGAGCAGAGTGTTCTTCTTCTGCATGCCTGCGCCCACAATCCCACGGGAGTGGACCCGCGTCCGGAACAGTGGAAGGAAATAGCAACAGTGGTGAAGAAAAGGAATCTCTTTGCGTTCTTTGACATGGCCTACCAAGGCTTTGCCAGTGGTGATGGTGATAAGGATGCCTGGGCTGTGCGCCACTTCATCGAACAGGGCATTAATGTTTGCCTCTGCCAATCATATGCCAAGAACATGGGCTTATATGGTGAGCGTGTAGGAGCCTTCACTATGGTCTGCAAAGATGCGGATGAAGCCAAAAGGGTAGAGTCACAGTTGAAGATCTTGATCCGTCCCATGTATTCCAACCCTCCCCTCAATGGGGCCCGGATTGCTGCTGCCATTCTGAACACCCCAGATTTGCGAAAACAATGGCTGCAAGAAGTGAAAGTCATGGCTGACCGCATCATTGGCATGCGGACTCAACTGGTCTCCAACCTCAAGAAGGAGGGTTCCACCCACAATTGGCAACACATCACCGACCAAATTGGCATGTTCTGTTTCACAGGGCTAAAGCCTGAACAGGTGGAGCGGCTGATCAAGGAGTTCTCCATCTACATGACAAAAGATGGCCGCATCTCTGTGGCAGGGGTCACCTCCAGCAACGTGGGCTACCTTGCCCATGCCATTCACCAGGTCACCAAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2587-Ab Anti-AATM/ GOT2/ KAT4 monoclonal antibody
    Target Antigen GM-Tg-g-MP2587-Ag GOT2 VLP (virus-like particle)
    ORF Viral Vector pGMLP002404 Human GOT2 Lentivirus plasmid
    ORF Viral Vector vGMLP002404 Human GOT2 Lentivirus particle


    Target information

    Target ID GM-MP2587
    Target Name GOT2
    Gene ID 2806, 14719, 707896, 25721, 101090160, 478103, 286886, 100052607
    Gene Symbol and Synonyms ASPATA,DEE82,FABP-1,FABP-pm,FABPpm,Got-2,GOT2,KAT4,KATIV,KYAT4,mAAT,mAspAT,mitAAT
    Uniprot Accession P00505
    Uniprot Entry Name AATM_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000125166
    Target Classification Not Available

    Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and inner-membrane mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.