Human GOT2/KAT4/ KATIV ORF/cDNA clone-Lentivirus plasmid (NM_002080)
Pre-made Human GOT2/KAT4/ KATIV Lentiviral expression plasmid for GOT2 lentivirus packaging, GOT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GOT2/KAT4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002404 | Human GOT2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002404 |
Gene Name | GOT2 |
Accession Number | NM_002080 |
Gene ID | 2806 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1293 bp |
Gene Alias | KAT4, KATIV, KYAT4, mitAAT |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCCTGCTGCACTCCGGCCGCGTCCTCCCCGGGATCGCCGCCGCCTTCCACCCGGGCCTCGCCGCCGCGGCCTCTGCCAGAGCCAGCTCCTGGTGGACCCATGTGGAAATGGGACCTCCAGATCCCATTCTGGGAGTCACTGAAGCCTTTAAGAGGGACACCAATAGCAAAAAGATGAATCTGGGAGTTGGTGCCTACCGGGATGATAATGGAAAGCCTTACGTTCTGCCTAGCGTCCGCAAGGCAGAGGCCCAGATTGCCGCAAAAAATTTGGACAAGGAATACCTGCCCATTGGGGGACTGGCTGAATTTTGCAAGGCATCTGCAGAACTAGCCCTGGGTGAGAACAGCGAAGTCTTGAAGAGTGGCCGGTTTGTCACTGTGCAGACCATTTCTGGAACTGGAGCCTTAAGGATCGGAGCCAGTTTTCTGCAAAGATTTTTTAAGTTCAGCCGAGATGTCTTTCTGCCCAAACCAACCTGGGGAAACCACACACCCATCTTCAGGGATGCTGGCATGCAGCTACAAGGTTATCGGTATTATGACCCCAAGACTTGCGGTTTTGACTTCACAGGCGCTGTGGAGGATATTTCAAAAATACCAGAGCAGAGTGTTCTTCTTCTGCATGCCTGCGCCCACAATCCCACGGGAGTGGACCCGCGTCCGGAACAGTGGAAGGAAATAGCAACAGTGGTGAAGAAAAGGAATCTCTTTGCGTTCTTTGACATGGCCTACCAAGGCTTTGCCAGTGGTGATGGTGATAAGGATGCCTGGGCTGTGCGCCACTTCATCGAACAGGGCATTAATGTTTGCCTCTGCCAATCATATGCCAAGAACATGGGCTTATATGGTGAGCGTGTAGGAGCCTTCACTATGGTCTGCAAAGATGCGGATGAAGCCAAAAGGGTAGAGTCACAGTTGAAGATCTTGATCCGTCCCATGTATTCCAACCCTCCCCTCAATGGGGCCCGGATTGCTGCTGCCATTCTGAACACCCCAGATTTGCGAAAACAATGGCTGCAAGAAGTGAAAGTCATGGCTGACCGCATCATTGGCATGCGGACTCAACTGGTCTCCAACCTCAAGAAGGAGGGTTCCACCCACAATTGGCAACACATCACCGACCAAATTGGCATGTTCTGTTTCACAGGGCTAAAGCCTGAACAGGTGGAGCGGCTGATCAAGGAGTTCTCCATCTACATGACAAAAGATGGCCGCATCTCTGTGGCAGGGGTCACCTCCAGCAACGTGGGCTACCTTGCCCATGCCATTCACCAGGTCACCAAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2587-Ab | Anti-AATM/ GOT2/ KAT4 monoclonal antibody |
Target Antigen | GM-Tg-g-MP2587-Ag | GOT2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002404 | Human GOT2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002404 | Human GOT2 Lentivirus particle |
Target information
Target ID | GM-MP2587 |
Target Name | GOT2 |
Gene ID | 2806, 14719, 707896, 25721, 101090160, 478103, 286886, 100052607 |
Gene Symbol and Synonyms | ASPATA,DEE82,FABP-1,FABP-pm,FABPpm,Got-2,GOT2,KAT4,KATIV,KYAT4,mAAT,mAspAT,mitAAT |
Uniprot Accession | P00505 |
Uniprot Entry Name | AATM_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000125166 |
Target Classification | Not Available |
Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and inner-membrane mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.