Human CSNK1E/CKIepsilon/ HCKIE ORF/cDNA clone-Lentivirus plasmid (NM_001894)

Pre-made Human CSNK1E/CKIepsilon/ HCKIE Lentiviral expression plasmid for CSNK1E lentivirus packaging, CSNK1E lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CSNK1E/CKIepsilon products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002478 Human CSNK1E Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002478
Gene Name CSNK1E
Accession Number NM_001894
Gene ID 1454
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1251 bp
Gene Alias CKIepsilon, HCKIE
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGCTACGTGTGGGGAACAAGTACCGCCTGGGACGGAAGATCGGGAGCGGGTCCTTCGGAGATATCTACCTGGGTGCCAACATCGCCTCTGGTGAGGAAGTCGCCATCAAGCTGGAGTGTGTGAAGACAAAGCACCCCCAGCTGCACATCGAGAGCAAGTTCTACAAGATGATGCAGGGTGGCGTGGGGATCCCGTCCATCAAGTGGTGCGGAGCTGAGGGCGACTACAACGTGATGGTCATGGAGCTGCTGGGGCCTAGCCTCGAGGACCTGTTCAACTTCTGTTCCCGCAAATTCAGCCTCAAGACGGTGCTGCTCTTGGCCGACCAGATGATCAGCCGCATCGAGTATATCCACTCCAAGAACTTCATCCACCGGGACGTCAAGCCCGACAACTTCCTCATGGGGCTGGGGAAGAAGGGCAACCTGGTCTACATCATCGACTTCGGCCTGGCCAAGAAGTACCGGGACGCCCGCACCCACCAGCACATTCCCTACCGGGAAAACAAGAACCTGACCGGCACGGCCCGCTACGCTTCCATCAACACGCACCTGGGCATTGAGCAAAGCCGTCGAGATGACCTGGAGAGCCTGGGCTACGTGCTCATGTACTTCAACCTGGGCTCCCTGCCCTGGCAGGGGCTCAAAGCAGCCACCAAGCGCCAGAAGTATGAACGGATCAGCGAGAAGAAGATGTCAACGCCCATCGAGGTCCTCTGCAAAGGCTATCCCTCCGAATTCTCAACATACCTCAACTTCTGCCGCTCCCTGCGGTTTGACGACAAGCCCGACTACTCTTACCTACGTCAGCTCTTCCGCAACCTCTTCCACCGGCAGGGCTTCTCCTATGACTACGTCTTTGACTGGAACATGCTGAAATTCGGTGCAGCCCGGAATCCCGAGGATGTGGACCGGGAGCGGCGAGAACACGAACGCGAGGAGAGGATGGGGCAGCTACGGGGGTCCGCGACCCGAGCCCTGCCCCCTGGCCCACCCACGGGGGCCACTGCCAACCGGCTCCGCAGTGCCGCCGAGCCCGTGGCTTCCACGCCAGCCTCCCGCATCCAGCCGGCTGGCAATACTTCTCCCAGAGCGATCTCGCGGGTCGACCGGGAGAGGAAGGTGAGTATGAGGCTGCACAGGGGTGCGCCCGCCAACGTCTCCTCCTCAGACCTCACTGGGCGGCAAGAGGTCTCCCGGATCCCAGCCTCACAGACAAGTGTGCCATTTGACCATCTCGGGAAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T99989-Ab Anti-CSNK1E monoclonal antibody
    Target Antigen GM-Tg-g-T99989-Ag CSNK1E protein
    ORF Viral Vector pGMLP002478 Human CSNK1E Lentivirus plasmid
    ORF Viral Vector pGMAP000186 Human CSNK1E Adenovirus plasmid
    ORF Viral Vector vGMLP002478 Human CSNK1E Lentivirus particle
    ORF Viral Vector vGMAP000186 Human CSNK1E Adenovirus particle


    Target information

    Target ID GM-T99989
    Target Name CSNK1E
    Gene ID 1454, 27373
    Gene Symbol and Synonyms CK1epsilon,CKIe,CKIepsilon,CSNK1E,HCKIE,KC1epsilon,tau
    Uniprot Accession P49674
    Uniprot Entry Name KC1E_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000213923
    Target Classification Kinase

    The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.