Human CSNK1E/HCKIE/MGC10398 ORF/cDNA clone-Adenovirus particle (BC006490)
Cat. No.: vGMAP000186
Pre-made Human CSNK1E/HCKIE/MGC10398 Adenovirus for CSNK1E overexpression in-vitro and in-vivo. The CSNK1E adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CSNK1E-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
CSNK1E/HCKIE products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000186 | Human CSNK1E Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000186 |
| Gene Name | CSNK1E |
| Accession Number | BC006490 |
| Gene ID | 1454 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1251 bp |
| Gene Alias | HCKIE,MGC10398 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGGAGCTACGTGTGGGGAACAAGTACCGCCTGGGACGGAAGATCGGGAGCGGGTCCTTCGGAGATATCTACCTGGGTGCCAACATCGCCTCTGGTGAGGAAGTCGCCATCAAGCTGGAGTGTGTGAAGACAAAGCACCCCCAGCTGCACATCGAGAGCAAGTTCTACAAGATGATGCAGGGTGGCGTGGGGATCCCGTCCATCAAGTGGTGCGGAGCTGAGGGCGACTACAACGTGATGGTCATGGAGCTGCTGGGGCCTAGCCTCGAGGACCTGTTCAACTTCTGTTCCCGCAAATTCAGCCTCAAGACGGTGCTGCTCTTGGCCGACCAGATGATCAGCCGCATCGAGTATATCCACTCCAAGAACTTCATCCACCGGGACGTCAAGCCCGACAACTTCCTCATGGGGCTGGGGAAGAAGGGCAACCTGGTCTACATCATCGACTTCGGCCTGGCCAAGAAGTACCGGGACGCCCGCACCCACCAGCACATTCCCTACCGGGAAAACAAGAACCTGACCGGCACGGCCCGCTACGCTTCCATCAACACGCACCTGGGCATTGAGCAAAGCCGTCGAGATGACCTGGAGAGCCTGGGCTACGTGCTCATGTACTTCAACCTGGGCTCCCTGCCCTGGCAGGGGCTCAAAGCAGCCACCAAGCGCCAGAAGTATGAACGGATCAGCGAGAAGAAGATGTCAACGCCCATCGAGGTCCTCTGCAAAGGCTATCCCTCCGAATTCTCAACATACCTCAACTTCTGCCGCTCCCTGCGGTTTGACGACAAGCCCGACTACTCTTACCTACGTCAGCTCTTCCGCAACCTCTTCCACCGGCAGGGCTTCTCCTATGACTACGTCTTTGACTGGAACATGCTGAAATTCGGTGCAGCCCGGAATCCCGAGGATGTGGACCGGGAGCGGCGAGAACACGAACGCGAGGAGAGGATGGGGCAGCTACGGGGGTCCGCGACCCGAGCCCTGCCCCCTGGCCCACCCACGGGGGCCACTGCCAACCGGCTCCGCAGTGCCGCCGAGCCCGTGGCTTCCACGCCAGCCTCCCGCATCCAGCCGGCTGGCAATACTTCTCCCAGAGCGATCTCGCGGGTCGACCGGGAGAGGAAGGTGAGTATGAGGCTGCACAGGGGTGCGCCCGCCAACGTCTCCTCCTCAGACCTCACTGGGCGGCAAGAGGTCTCCCGGATCCCAGCCTCACAGACAAGTGTGCCATTTGACCATCTCGGGAAGTGA |
| ORF Protein Sequence | MELRVGNKYRLGRKIGSGSFGDIYLGANIASGEEVAIKLECVKTKHPQLHIESKFYKMMQGGVGIPSIKWCGAEGDYNVMVMELLGPSLEDLFNFCSRKFSLKTVLLLADQMISRIEYIHSKNFIHRDVKPDNFLMGLGKKGNLVYIIDFGLAKKYRDARTHQHIPYRENKNLTGTARYASINTHLGIEQSRRDDLESLGYVLMYFNLGSLPWQGLKAATKRQKYERISEKKMSTPIEVLCKGYPSEFSTYLNFCRSLRFDDKPDYSYLRQLFRNLFHRQGFSYDYVFDWNMLKFGAARNPEDVDRERREHEREERMGQLRGSATRALPPGPPTGATANRLRSAAEPVASTPASRIQPAGNTSPRAISRVDRERKVSMRLHRGAPANVSSSDLTGRQEVSRIPASQTSVPFDHLGK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T99989-Ab | Anti-CSNK1E monoclonal antibody |
| Target Antigen | GM-Tg-g-T99989-Ag | CSNK1E protein |
| ORF Viral Vector | pGMLP002478 | Human CSNK1E Lentivirus plasmid |
| ORF Viral Vector | pGMLP005309 | Human CSNK1E Lentivirus plasmid |
| ORF Viral Vector | pGMAP000186 | Human CSNK1E Adenovirus plasmid |
| ORF Viral Vector | vGMLP002478 | Human CSNK1E Lentivirus particle |
| ORF Viral Vector | vGMLP005309 | Human CSNK1E Lentivirus particle |
| ORF Viral Vector | vGMAP000186 | Human CSNK1E Adenovirus particle |
Target information
| Target ID | GM-T99989 |
| Target Name | CSNK1E |
| Gene ID | 1454, 27373 |
| Gene Symbol and Synonyms | CK1epsilon,CKIe,CKIepsilon,CSNK1E,HCKIE,KC1epsilon,tau |
| Uniprot Accession | P49674 |
| Uniprot Entry Name | KC1E_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Breast Cancer |
| Gene Ensembl | ENSG00000213923 |
| Target Classification | Kinase |
The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2014]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


