Human CSNK1E/CKIepsilon/ HCKIE ORF/cDNA clone-Lentivirus particle (NM_001894)
Pre-made Human CSNK1E/CKIepsilon/ HCKIE Lentiviral expression plasmid for CSNK1E lentivirus packaging, CSNK1E lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CSNK1E/CKIepsilon products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002478 | Human CSNK1E Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002478 |
Gene Name | CSNK1E |
Accession Number | NM_001894 |
Gene ID | 1454 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1251 bp |
Gene Alias | CKIepsilon, HCKIE |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGCTACGTGTGGGGAACAAGTACCGCCTGGGACGGAAGATCGGGAGCGGGTCCTTCGGAGATATCTACCTGGGTGCCAACATCGCCTCTGGTGAGGAAGTCGCCATCAAGCTGGAGTGTGTGAAGACAAAGCACCCCCAGCTGCACATCGAGAGCAAGTTCTACAAGATGATGCAGGGTGGCGTGGGGATCCCGTCCATCAAGTGGTGCGGAGCTGAGGGCGACTACAACGTGATGGTCATGGAGCTGCTGGGGCCTAGCCTCGAGGACCTGTTCAACTTCTGTTCCCGCAAATTCAGCCTCAAGACGGTGCTGCTCTTGGCCGACCAGATGATCAGCCGCATCGAGTATATCCACTCCAAGAACTTCATCCACCGGGACGTCAAGCCCGACAACTTCCTCATGGGGCTGGGGAAGAAGGGCAACCTGGTCTACATCATCGACTTCGGCCTGGCCAAGAAGTACCGGGACGCCCGCACCCACCAGCACATTCCCTACCGGGAAAACAAGAACCTGACCGGCACGGCCCGCTACGCTTCCATCAACACGCACCTGGGCATTGAGCAAAGCCGTCGAGATGACCTGGAGAGCCTGGGCTACGTGCTCATGTACTTCAACCTGGGCTCCCTGCCCTGGCAGGGGCTCAAAGCAGCCACCAAGCGCCAGAAGTATGAACGGATCAGCGAGAAGAAGATGTCAACGCCCATCGAGGTCCTCTGCAAAGGCTATCCCTCCGAATTCTCAACATACCTCAACTTCTGCCGCTCCCTGCGGTTTGACGACAAGCCCGACTACTCTTACCTACGTCAGCTCTTCCGCAACCTCTTCCACCGGCAGGGCTTCTCCTATGACTACGTCTTTGACTGGAACATGCTGAAATTCGGTGCAGCCCGGAATCCCGAGGATGTGGACCGGGAGCGGCGAGAACACGAACGCGAGGAGAGGATGGGGCAGCTACGGGGGTCCGCGACCCGAGCCCTGCCCCCTGGCCCACCCACGGGGGCCACTGCCAACCGGCTCCGCAGTGCCGCCGAGCCCGTGGCTTCCACGCCAGCCTCCCGCATCCAGCCGGCTGGCAATACTTCTCCCAGAGCGATCTCGCGGGTCGACCGGGAGAGGAAGGTGAGTATGAGGCTGCACAGGGGTGCGCCCGCCAACGTCTCCTCCTCAGACCTCACTGGGCGGCAAGAGGTCTCCCGGATCCCAGCCTCACAGACAAGTGTGCCATTTGACCATCTCGGGAAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T99989-Ab | Anti-CSNK1E monoclonal antibody |
Target Antigen | GM-Tg-g-T99989-Ag | CSNK1E protein |
ORF Viral Vector | pGMLP002478 | Human CSNK1E Lentivirus plasmid |
ORF Viral Vector | pGMAP000186 | Human CSNK1E Adenovirus plasmid |
ORF Viral Vector | vGMLP002478 | Human CSNK1E Lentivirus particle |
ORF Viral Vector | vGMAP000186 | Human CSNK1E Adenovirus particle |
Target information
Target ID | GM-T99989 |
Target Name | CSNK1E |
Gene ID | 1454, 27373 |
Gene Symbol and Synonyms | CK1epsilon,CKIe,CKIepsilon,CSNK1E,HCKIE,KC1epsilon,tau |
Uniprot Accession | P49674 |
Uniprot Entry Name | KC1E_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000213923 |
Target Classification | Kinase |
The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.