Human PSMD9/p27/Rpn4 ORF/cDNA clone-Lentivirus plasmid (NM_002813)

Cat. No.: pGMLP002650
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PSMD9/p27/Rpn4 Lentiviral expression plasmid for PSMD9 lentivirus packaging, PSMD9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PSMD9/p27 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $468
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002650
Gene Name PSMD9
Accession Number NM_002813
Gene ID 5715
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 672 bp
Gene Alias p27,Rpn4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTCGCAGGCCGGCGTCGTGACTGTCAGCGACGTCCAGGAGCTGATGCGGCGCAAGGAGGAGATAGAAGCGCAGATCAAGGCCAACTATGACGTGCTGGAAAGCCAAAAAGGCATTGGGATGAACGAGCCGCTGGTGGACTGTGAGGGCTACCCCCGGTCAGACGTGGACCTGTACCAAGTCCGCACCGCCAGGCACAACATCATATGCCTGCAGAATGATCACAAGGCAGTGATGAAGCAGGTGGAGGAGGCCCTGCACCAGCTGCACGCTCGCGACAAGGAGAAGCAGGCCCGGGACATGGCTGAGGCCCACAAAGAGGCCATGAGCCGCAAACTGGGTCAGAGTGAGAGCCAGGGCCCTCCACGGGCCTTCGCCAAAGTGAACAGCATCAGCCCCGGCTCCCCAGCCAGCATCGCGGGTCTGCAAGTGGATGATGAGATTGTGGAGTTCGGCTCTGTGAACACCCAGAACTTCCAGTCACTGCATAACATTGGCAGTGTGGTGCAGCACAGTGAGGGGAAGCCCCTGAATGTGACAGTGATCCGCAGGGGGGAAAAACACCAGCTTAGACTTGTTCCAACACGCTGGGCAGGAAAAGGACTGCTGGGCTGCAACATTATTCCTCTGCAAAGATGA
ORF Protein Sequence MSDEEARQSGGSSQAGVVTVSDVQELMRRKEEIEAQIKANYDVLESQKGIGMNEPLVDCEGYPRSDVDLYQVRTARHNIICLQNDHKAVMKQVEEALHQLHARDKEKQARDMAEAHKEAMSRKLGQSESQGPPRAFAKVNSISPGSPASIAGLQVDDEIVEFGSVNTQNFQSLHNIGSVVQHSEGKPLNVTVIRRGEKHQLRLVPTRWAGKGLLGCNIIPLQR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2677-Ab Anti-PSMD9 monoclonal antibody
    Target Antigen GM-Tg-g-IP2677-Ag PSMD9 protein
    ORF Viral Vector pGMLP002650 Human PSMD9 Lentivirus plasmid
    ORF Viral Vector pGMAP000241 Human PSMD9 Adenovirus plasmid
    ORF Viral Vector vGMLP002650 Human PSMD9 Lentivirus particle
    ORF Viral Vector vGMAP000241 Human PSMD9 Adenovirus particle


    Target information

    Target ID GM-IP2677
    Target Name PSMD9
    Gene ID 5715, 67151, 701174, 161475, 101093051, 477467, 513315, 100058668
    Gene Symbol and Synonyms 1500011J20Rik,2610202L11Rik,Bridge,Bridge-1,p27,PSMD9,Rpn4
    Uniprot Accession O00233
    Uniprot Entry Name PSMD9_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000110801
    Target Classification Not Available

    The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.