Human PSMD9/MGC8644/p27 ORF/cDNA clone-Adenovirus particle (BC002383)

Cat. No.: vGMAP000241

Pre-made Human PSMD9/MGC8644/p27 Adenovirus for PSMD9 overexpression in-vitro and in-vivo. The PSMD9 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PSMD9-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to PSMD9/MGC8644 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000241 Human PSMD9 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000241
Gene Name PSMD9
Accession Number BC002383
Gene ID 5715
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 672 bp
Gene Alias MGC8644,p27
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTCGCAGGCCGGCGTCGTGACTGTCAGCGACGTCCAGGAGCTGATGCGGCGCAAGGAGGAGATAGAAGCGCAGATCAAGGCCAACTATGACGTGCTGGAAAGCCAAAAAGGCATTGGGATGAACGAGCCGCTGGTGGACTGTGAGGGCTACCCCCGGTCAGACGTGGACCTGTACCAAGTCCGCACCGCCAGGCACAACATCATATGCCTGCAGAATGATCACAAGGCAGTGATGAAGCAGGTGGAGGAGGCCCTGCACCAGCTGCACGCTCGCGACAAGGAGAAGCAGGCCCGGGACATGGCTGAGGCCCACAAAGAGGCCATGAGCCGCAAACTGGGTCAGAGTGAGAGCCAGGGCCCTCCACGGGCCTTCGCCAAAGTGAACAGCATCAGCCCCGGCTCCCCAGCCAGCATCGCGGGTCTGCAAGTGGATGATGAGATTGTGGAGTTCGGCTCTGTGAACACCCAGAACTTCCAGTCACTGCATAACATTGGCAGTGTGGTGCAGCACAGTGAGGGGAAGCCCCTGAATGTGACAGTGATCCGCAGGGGGGAAAAACACCAGCTTAGACTTGTTCCAACACGCTGGGCAGGAAAAGGACTGCTGGGCTGCAACATTATTCCTCTGCAAAGATGA
ORF Protein Sequence MSDEEARQSGGSSQAGVVTVSDVQELMRRKEEIEAQIKANYDVLESQKGIGMNEPLVDCEGYPRSDVDLYQVRTARHNIICLQNDHKAVMKQVEEALHQLHARDKEKQARDMAEAHKEAMSRKLGQSESQGPPRAFAKVNSISPGSPASIAGLQVDDEIVEFGSVNTQNFQSLHNIGSVVQHSEGKPLNVTVIRRGEKHQLRLVPTRWAGKGLLGCNIIPLQR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2677-Ab Anti-PSMD9 monoclonal antibody
    Target Antigen GM-Tg-g-IP2677-Ag PSMD9 protein
    ORF Viral Vector pGMLP002650 Human PSMD9 Lentivirus plasmid
    ORF Viral Vector pGMAP000241 Human PSMD9 Adenovirus plasmid
    ORF Viral Vector vGMLP002650 Human PSMD9 Lentivirus particle
    ORF Viral Vector vGMAP000241 Human PSMD9 Adenovirus particle


    Target information

    Target ID GM-IP2677
    Target Name PSMD9
    Gene ID 5715, 67151, 701174, 161475, 101093051, 477467, 513315, 100058668
    Gene Symbol and Synonyms 1500011J20Rik,2610202L11Rik,Bridge,Bridge-1,p27,PSMD9,Rpn4
    Uniprot Accession O00233
    Uniprot Entry Name PSMD9_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000110801
    Target Classification Not Available

    The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.