Human PSMD9/p27/Rpn4 ORF/cDNA clone-Lentivirus particle (NM_002813)
Cat. No.: vGMLP002650
Pre-made Human PSMD9/p27/Rpn4 Lentiviral expression plasmid for PSMD9 lentivirus packaging, PSMD9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
PSMD9/p27 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002650 | Human PSMD9 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002650 |
Gene Name | PSMD9 |
Accession Number | NM_002813 |
Gene ID | 5715 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 672 bp |
Gene Alias | p27,Rpn4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTCGCAGGCCGGCGTCGTGACTGTCAGCGACGTCCAGGAGCTGATGCGGCGCAAGGAGGAGATAGAAGCGCAGATCAAGGCCAACTATGACGTGCTGGAAAGCCAAAAAGGCATTGGGATGAACGAGCCGCTGGTGGACTGTGAGGGCTACCCCCGGTCAGACGTGGACCTGTACCAAGTCCGCACCGCCAGGCACAACATCATATGCCTGCAGAATGATCACAAGGCAGTGATGAAGCAGGTGGAGGAGGCCCTGCACCAGCTGCACGCTCGCGACAAGGAGAAGCAGGCCCGGGACATGGCTGAGGCCCACAAAGAGGCCATGAGCCGCAAACTGGGTCAGAGTGAGAGCCAGGGCCCTCCACGGGCCTTCGCCAAAGTGAACAGCATCAGCCCCGGCTCCCCAGCCAGCATCGCGGGTCTGCAAGTGGATGATGAGATTGTGGAGTTCGGCTCTGTGAACACCCAGAACTTCCAGTCACTGCATAACATTGGCAGTGTGGTGCAGCACAGTGAGGGGAAGCCCCTGAATGTGACAGTGATCCGCAGGGGGGAAAAACACCAGCTTAGACTTGTTCCAACACGCTGGGCAGGAAAAGGACTGCTGGGCTGCAACATTATTCCTCTGCAAAGATGA |
ORF Protein Sequence | MSDEEARQSGGSSQAGVVTVSDVQELMRRKEEIEAQIKANYDVLESQKGIGMNEPLVDCEGYPRSDVDLYQVRTARHNIICLQNDHKAVMKQVEEALHQLHARDKEKQARDMAEAHKEAMSRKLGQSESQGPPRAFAKVNSISPGSPASIAGLQVDDEIVEFGSVNTQNFQSLHNIGSVVQHSEGKPLNVTVIRRGEKHQLRLVPTRWAGKGLLGCNIIPLQR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP2677-Ab | Anti-PSMD9 monoclonal antibody |
Target Antigen | GM-Tg-g-IP2677-Ag | PSMD9 protein |
ORF Viral Vector | pGMLP002650 | Human PSMD9 Lentivirus plasmid |
ORF Viral Vector | pGMAP000241 | Human PSMD9 Adenovirus plasmid |
ORF Viral Vector | vGMLP002650 | Human PSMD9 Lentivirus particle |
ORF Viral Vector | vGMAP000241 | Human PSMD9 Adenovirus particle |
Target information
Target ID | GM-IP2677 |
Target Name | PSMD9 |
Gene ID | 5715, 67151, 701174, 161475, 101093051, 477467, 513315, 100058668 |
Gene Symbol and Synonyms | 1500011J20Rik,2610202L11Rik,Bridge,Bridge-1,p27,PSMD9,Rpn4 |
Uniprot Accession | O00233 |
Uniprot Entry Name | PSMD9_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000110801 |
Target Classification | Not Available |
The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.