Human CALCR/CRT/ CT-R ORF/cDNA clone-Lentivirus plasmid (NM_001742)
Pre-made Human CALCR/CRT/ CT-R Lentiviral expression plasmid for CALCR lentivirus packaging, CALCR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CALCR/CRT products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002726 | Human CALCR Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002726 |
Gene Name | CALCR |
Accession Number | NM_001742 |
Gene ID | 799 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1425 bp |
Gene Alias | CRT, CT-R, CTR, CTR1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGTTCACATTTACAAGCCGGTGCTTGGCACTGTTTCTTCTTCTAAATCACCCAACCCCAATTCTTCCTGCCTTTTCAAATCAAACCTATCCAACAATAGAGCCCAAGCCATTTCTTTACGTCGTAGGACGAAAGAAGATGATGGATGCACAGTACAAATGCTATGACCGAATGCAGCAGTTACCCGCATACCAAGGAGAAGGTCCATATTGCAATCGCACCTGGGATGGATGGCTGTGCTGGGATGACACACCGGCTGGAGTATTGTCCTATCAGTTCTGCCCAGATTATTTTCCGGATTTTGATCCATCAGAAAAGGTTACAAAATACTGTGATGAAAAAGGTGTTTGGTTTAAACATCCTGAAAACAATCGAACCTGGTCCAACTATACTATGTGCAATGCTTTCACTCCTGAGAAACTGAAGAATGCATATGTTCTGTACTATTTGGCTATTGTGGGTCATTCTTTGTCAATTTTCACCCTAGTGATTTCCCTGGGGATTTTCGTGTTTTTCAGGAGCCTTGGCTGCCAAAGGGTAACCCTGCACAAGAACATGTTTCTTACTTACATTCTGAATTCTATGATTATCATCATCCACCTGGTTGAAGTAGTACCCAATGGAGAGCTCGTGCGAAGGGACCCGGTGAGCTGCAAGATTTTGCATTTTTTCCACCAGTACATGATGGCCTGCAACTATTTCTGGATGCTCTGTGAAGGGATCTATCTTCATACACTCATTGTCGTGGCTGTGTTTACTGAGAAGCAACGCTTGCGGTGGTATTATCTCTTGGGCTGGGGGTTCCCGCTGGTGCCAACCACTATCCATGCTATTACCAGGGCCGTGTACTTCAATGACAACTGCTGGCTGAGTGTGGAAACCCATTTGCTTTACATAATCCATGGACCTGTCATGGCGGCACTTGTGGTCAATTTCTTCTTTTTGCTCAACATTGTCCGGGTGCTTGTGACCAAAATGAGGGAAACCCATGAGGCGGAATCCCACATGTACCTGAAGGCTGTGAAGGCCACCATGATCCTTGTGCCCCTGCTGGGAATCCAGTTTGTCGTCTTTCCCTGGAGACCTTCCAACAAGATGCTTGGGAAGATATATGATTACGTGATGCACTCTCTGATTCATTTCCAGGGCTTCTTTGTTGCGACCATCTACTGCTTCTGCAACAATGAGGTCCAAACCACCGTGAAGCGCCAATGGGCCCAATTCAAAATTCAGTGGAACCAGCGTTGGGGGAGGCGCCCCTCCAACCGCTCTGCTCGCGCTGCAGCCGCTGCTGCGGAGGCTGGCGACATCCCAATTTACATCTGCCATCAGGAGCTGAGGAATGAACCAGCCAACAACCAAGGCGAGGAGAGTGCTGAGATCATCCCTTTGAATATCATAGAGCAAGAGTCATCTGCTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T32247-Ab | Anti-CALCR/ CRT/ CT-R monoclonal antibody |
Target Antigen | GM-Tg-g-T32247-Ag | CALCR VLP (virus-like particle) |
ORF Viral Vector | pGMLV001927 | Rat Calcr Lentivirus plasmid |
ORF Viral Vector | pGMLP002726 | Human CALCR Lentivirus plasmid |
ORF Viral Vector | vGMLV001927 | Rat Calcr Lentivirus particle |
ORF Viral Vector | vGMLP002726 | Human CALCR Lentivirus particle |
Target information
Target ID | GM-T32247 |
Target Name | CALCR |
Gene ID | 799, 12311, 701093, 116506, 101087825, 482306, 613317, 100061915 |
Gene Symbol and Synonyms | CALCR,Clr,CRT,CT-R,CTR,CTR1 |
Uniprot Accession | P30988 |
Uniprot Entry Name | CALCR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000004948 |
Target Classification | Not Available |
This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.