Human CALCR/CRT/ CT-R ORF/cDNA clone-Lentivirus particle (NM_001742)

Pre-made Human CALCR/CRT/ CT-R Lentiviral expression plasmid for CALCR lentivirus packaging, CALCR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CALCR/CRT products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002726 Human CALCR Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002726
Gene Name CALCR
Accession Number NM_001742
Gene ID 799
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1425 bp
Gene Alias CRT, CT-R, CTR, CTR1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGTTCACATTTACAAGCCGGTGCTTGGCACTGTTTCTTCTTCTAAATCACCCAACCCCAATTCTTCCTGCCTTTTCAAATCAAACCTATCCAACAATAGAGCCCAAGCCATTTCTTTACGTCGTAGGACGAAAGAAGATGATGGATGCACAGTACAAATGCTATGACCGAATGCAGCAGTTACCCGCATACCAAGGAGAAGGTCCATATTGCAATCGCACCTGGGATGGATGGCTGTGCTGGGATGACACACCGGCTGGAGTATTGTCCTATCAGTTCTGCCCAGATTATTTTCCGGATTTTGATCCATCAGAAAAGGTTACAAAATACTGTGATGAAAAAGGTGTTTGGTTTAAACATCCTGAAAACAATCGAACCTGGTCCAACTATACTATGTGCAATGCTTTCACTCCTGAGAAACTGAAGAATGCATATGTTCTGTACTATTTGGCTATTGTGGGTCATTCTTTGTCAATTTTCACCCTAGTGATTTCCCTGGGGATTTTCGTGTTTTTCAGGAGCCTTGGCTGCCAAAGGGTAACCCTGCACAAGAACATGTTTCTTACTTACATTCTGAATTCTATGATTATCATCATCCACCTGGTTGAAGTAGTACCCAATGGAGAGCTCGTGCGAAGGGACCCGGTGAGCTGCAAGATTTTGCATTTTTTCCACCAGTACATGATGGCCTGCAACTATTTCTGGATGCTCTGTGAAGGGATCTATCTTCATACACTCATTGTCGTGGCTGTGTTTACTGAGAAGCAACGCTTGCGGTGGTATTATCTCTTGGGCTGGGGGTTCCCGCTGGTGCCAACCACTATCCATGCTATTACCAGGGCCGTGTACTTCAATGACAACTGCTGGCTGAGTGTGGAAACCCATTTGCTTTACATAATCCATGGACCTGTCATGGCGGCACTTGTGGTCAATTTCTTCTTTTTGCTCAACATTGTCCGGGTGCTTGTGACCAAAATGAGGGAAACCCATGAGGCGGAATCCCACATGTACCTGAAGGCTGTGAAGGCCACCATGATCCTTGTGCCCCTGCTGGGAATCCAGTTTGTCGTCTTTCCCTGGAGACCTTCCAACAAGATGCTTGGGAAGATATATGATTACGTGATGCACTCTCTGATTCATTTCCAGGGCTTCTTTGTTGCGACCATCTACTGCTTCTGCAACAATGAGGTCCAAACCACCGTGAAGCGCCAATGGGCCCAATTCAAAATTCAGTGGAACCAGCGTTGGGGGAGGCGCCCCTCCAACCGCTCTGCTCGCGCTGCAGCCGCTGCTGCGGAGGCTGGCGACATCCCAATTTACATCTGCCATCAGGAGCTGAGGAATGAACCAGCCAACAACCAAGGCGAGGAGAGTGCTGAGATCATCCCTTTGAATATCATAGAGCAAGAGTCATCTGCTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32247-Ab Anti-CALCR/ CRT/ CT-R monoclonal antibody
    Target Antigen GM-Tg-g-T32247-Ag CALCR VLP (virus-like particle)
    ORF Viral Vector pGMLV001927 Rat Calcr Lentivirus plasmid
    ORF Viral Vector pGMLP002726 Human CALCR Lentivirus plasmid
    ORF Viral Vector vGMLV001927 Rat Calcr Lentivirus particle
    ORF Viral Vector vGMLP002726 Human CALCR Lentivirus particle


    Target information

    Target ID GM-T32247
    Target Name CALCR
    Gene ID 799, 12311, 701093, 116506, 101087825, 482306, 613317, 100061915
    Gene Symbol and Synonyms CALCR,Clr,CRT,CT-R,CTR,CTR1
    Uniprot Accession P30988
    Uniprot Entry Name CALCR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000004948
    Target Classification Not Available

    This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.