Human IL18/IGIF/ IL-18 ORF/cDNA clone-Lentivirus plasmid (NM_001562)

Pre-made Human IL18/IGIF/ IL-18 Lentiviral expression plasmid for IL18 lentivirus packaging, IL18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IL18/IGIF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002771 Human IL18 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002771
Gene Name IL18
Accession Number NM_001562
Gene ID 3606
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 582 bp
Gene Alias IGIF, IL-18, IL-1g, IL1F4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGCTGAACCAGTAGAAGACAATTGCATCAACTTTGTGGCAATGAAATTTATTGACAATACGCTTTACTTTATAGCTGAAGATGATGAAAACCTGGAATCAGATTACTTTGGCAAGCTTGAATCTAAATTATCAGTCATAAGAAATTTGAATGACCAAGTTCTCTTCATTGACCAAGGAAATCGGCCTCTATTTGAAGATATGACTGATTCTGACTGTAGAGATAATGCACCCCGGACCATATTTATTATAAGTATGTATAAAGATAGCCAGCCTAGAGGTATGGCTGTAACTATCTCTGTGAAGTGTGAGAAAATTTCAACTCTCTCCTGTGAGAACAAAATTATTTCCTTTAAGGAAATGAATCCTCCTGATAACATCAAGGATACAAAAAGTGACATCATATTCTTTCAGAGAAGTGTCCCAGGACATGATAATAAGATGCAATTTGAATCTTCATCATACGAAGGATACTTTCTAGCTTGTGAAAAAGAGAGAGACCTTTTTAAACTCATTTTGAAAAAAGAGGATGAATTGGGGGATAGATCTATAATGTTCACTGTTCAAAACGAAGACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T06671-Ab Anti-IL18/ IGIF/ IL-18 functional antibody
    Target Antigen GM-Tg-g-T06671-Ag IL18 protein
    Cytokine cks-Tg-g-GM-T06671 interleukin 18 (IL18) protein & antibody
    ORF Viral Vector pGMLP002771 Human IL18 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-025 Human IL18 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-108 Human IL18 Adenovirus plasmid
    ORF Viral Vector vGMLP002771 Human IL18 Lentivirus particle
    ORF Viral Vector vGMLP-IL-025 Human IL18 Lentivirus particle
    ORF Viral Vector vGMAP-IL-108 Human IL18 Adenovirus particle


    Target information

    Target ID GM-T06671
    Target Name IL18
    Gene ID 3606, 16173, 574151, 29197, 493688, 403796, 281249, 100034216
    Gene Symbol and Synonyms IGIF,IL-1 gamma,IL-18,IL-1g,IL18,IL1F4
    Uniprot Accession Q14116
    Uniprot Entry Name IL18_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Breast Cancer, Acute kidney failure, Overweight
    Gene Ensembl ENSG00000150782
    Target Classification Not Available

    The protein encoded by this gene is a proinflammatory cytokine of the IL-1 family that is constitutively found as a precursor within the cytoplasm of a variety of cells including macrophages and keratinocytes. The inactive IL-18 precursor is processed to its active form by caspase-1, and is capable of stimulating interferon gamma production, and of regulating both T helper (Th) 1 and Th2 responses. This cytokine has been implicated in the injury of different organs, and in potentially fatal conditions characterized by a cytokine storm. In humans, IL-18 gene is located on chromosome 11. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.