Human IL18/IGIF/IL-18 ORF/cDNA clone-Lentivirus particle (NM_001562)
Cat. No.: vGMLP-IL-025
Pre-made Human IL18/IGIF/IL-18 Lentiviral expression plasmid for IL18 lentivirus packaging, IL18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
IL18/IGIF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP-IL-025 | Human IL18 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP-IL-025 |
| Gene Name | IL18 |
| Accession Number | NM_001562 |
| Gene ID | 3606 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 582 bp |
| Gene Alias | IGIF,IL-18,IL-1g,IL1F4 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCTGCTGAACCAGTAGAAGACAATTGCATCAACTTTGTGGCAATGAAATTTATTGACAATACGCTTTACTTTATAGCTGAAGATGATGAAAACCTGGAATCAGATTACTTTGGCAAGCTTGAATCTAAATTATCAGTCATAAGAAATTTGAATGACCAAGTTCTCTTCATTGACCAAGGAAATCGGCCTCTATTTGAAGATATGACTGATTCTGACTGTAGAGATAATGCACCCCGGACCATATTTATTATAAGTATGTATAAAGATAGCCAGCCTAGAGGTATGGCTGTAACTATCTCTGTGAAGTGTGAGAAAATTTCAACTCTCTCCTGTGAGAACAAAATTATTTCCTTTAAGGAAATGAATCCTCCTGATAACATCAAGGATACAAAAAGTGACATCATATTCTTTCAGAGAAGTGTCCCAGGACATGATAATAAGATGCAATTTGAATCTTCATCATACGAAGGATACTTTCTAGCTTGTGAAAAAGAGAGAGACCTTTTTAAACTCATTTTGAAAAAAGAGGATGAATTGGGGGATAGATCTATAATGTTCACTGTTCAAAACGAAGACTAG |
| ORF Protein Sequence | MAAEPVEDNCINFVAMKFIDNTLYFIAEDDENLESDYFGKLESKLSVIRNLNDQVLFIDQGNRPLFEDMTDSDCRDNAPRTIFIISMYKDSQPRGMAVTISVKCEKISTLSCENKIISFKEMNPPDNIKDTKSDIIFFQRSVPGHDNKMQFESSSYEGYFLACEKERDLFKLILKKEDELGDRSIMFTVQNED |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T06671-Ab | Anti-IL18/ IGIF/ IL-18 functional antibody |
| Target Antigen | GM-Tg-g-T06671-Ag | IL18 protein |
| Cytokine | cks-Tg-g-GM-T06671 | interleukin 18 (IL18) protein & antibody |
| ORF Viral Vector | pGMLP002771 | Human IL18 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-IL-025 | Human IL18 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-IL-108 | Human IL18 Adenovirus plasmid |
| ORF Viral Vector | vGMLP002771 | Human IL18 Lentivirus particle |
| ORF Viral Vector | vGMLP-IL-025 | Human IL18 Lentivirus particle |
| ORF Viral Vector | vGMAP-IL-108 | Human IL18 Adenovirus particle |
Target information
| Target ID | GM-T06671 |
| Target Name | IL18 |
| Gene ID | 3606, 16173, 574151, 29197, 493688, 403796, 281249, 100034216 |
| Gene Symbol and Synonyms | IGIF,IL-1 gamma,IL-18,IL-1g,IL18,IL1F4 |
| Uniprot Accession | Q14116 |
| Uniprot Entry Name | IL18_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Cytokine Target |
| Disease | Breast Cancer, Acute kidney failure, Overweight |
| Gene Ensembl | ENSG00000150782 |
| Target Classification | Not Available |
The protein encoded by this gene is a proinflammatory cytokine of the IL-1 family that is constitutively found as a precursor within the cytoplasm of a variety of cells including macrophages and keratinocytes. The inactive IL-18 precursor is processed to its active form by caspase-1, and is capable of stimulating interferon gamma production, and of regulating both T helper (Th) 1 and Th2 responses. This cytokine has been implicated in the injury of different organs, and in potentially fatal conditions characterized by a cytokine storm. In humans, IL-18 gene is located on chromosome 11. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2020]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


