Human SURF1/CMT4K ORF/cDNA clone-Lentivirus plasmid (NM_003172)
Cat. No.: pGMLP002818
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SURF1/CMT4K Lentiviral expression plasmid for SURF1 lentivirus packaging, SURF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SURF1/CMT4K products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002818 |
Gene Name | SURF1 |
Accession Number | NM_003172 |
Gene ID | 6834 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 903 bp |
Gene Alias | CMT4K |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGGCGGTGGCTGCGTTGCAGCTGGGGCTGCGGGCGGCGGGGCTGGGACGGGCCCCGGCCAGCGCCGCCTGGAGGAGCGTCCTCAGGGTCTCCCCGCGCCCAGGGGTGGCCTGGAGGCCAAGCAGATGTGGCAGTTCTGCAGCAGAAGCATCTGCCACAAAAGCGGAAGATGACTCCTTTCTTCAGTGGGTCCTGCTCCTCATCCCTGTGACTGCCTTTGGCTTGGGGACATGGCAGGTCCAGCGTCGGAAGTGGAAGCTGAACCTGATTGCAGAGTTGGAGTCCAGAGTTCTGGCTGAGCCTGTCCCTCTGCCAGCCGACCCAATGGAACTGAAAAATCTGGAGTATAGGCCAGTGAAGGTCAGGGGGTGCTTTGACCATTCCAAGGAGCTGTATATGATGCCCCGGACCATGGTGGACCCTGTCCGGGAGGCCCGGGAGGGCGGCCTCATCTCCTCCTCAACTCAGAGTGGGGCCTATGTGGTCACTCCCTTCCACTGCACCGACCTGGGAGTCACCATCCTGGTAAATAGAGGGTTCGTTCCCAGGAAGAAAGTGAATCCTGAAACCCGGCAGAAAGGCCAGATTGAGGGAGAAGTGGACCTCATTGGGATGGTGAGGCTGACAGAAACCAGGCAGCCTTTTGTCCCTGAGAACAATCCAGAAAGGAACCACTGGCATTATCGAGACCTGGAAGCTATGGCCAGAATCACAGGCGCAGAGCCCATCTTCATTGATGCCAACTTCCAGAGCACAGTCCCTGGAGGACCCATTGGAGGGCAAACCAGAGTTACTCTGAGGAACGAGCATCTGCAGTACATCGTGACCTGGTATGGACTCTCTGCAGCTACATCCTACCTGTGGTTTAAGAAATTCCTACGTGGGACACCTGGTGTGTGA |
ORF Protein Sequence | MAAVAALQLGLRAAGLGRAPASAAWRSVLRVSPRPGVAWRPSRCGSSAAEASATKAEDDSFLQWVLLLIPVTAFGLGTWQVQRRKWKLNLIAELESRVLAEPVPLPADPMELKNLEYRPVKVRGCFDHSKELYMMPRTMVDPVREAREGGLISSSTQSGAYVVTPFHCTDLGVTILVNRGFVPRKKVNPETRQKGQIEGEVDLIGMVRLTETRQPFVPENNPERNHWHYRDLEAMARITGAEPIFIDANFQSTVPGGPIGGQTRVTLRNEHLQYIVTWYGLSAATSYLWFKKFLRGTPGV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1858-Ab | Anti-SURF1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP1858-Ag | SURF1 protein |
ORF Viral Vector | pGMLP002818 | Human SURF1 Lentivirus plasmid |
ORF Viral Vector | pGMLP003881 | Human SURF1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002818 | Human SURF1 Lentivirus particle |
ORF Viral Vector | vGMLP003881 | Human SURF1 Lentivirus particle |
Target information
Target ID | GM-IP1858 |
Target Name | SURF1 |
Gene ID | 6834, 20930, 722212, 64463, 101085249, 480681, 100139115 |
Gene Symbol and Synonyms | 0610010F23Rik,Ab1-205,CMT4K,MC4DN1,SHY1,Surf-1,SURF1 |
Uniprot Accession | Q15526 |
Uniprot Entry Name | SURF1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000148290 |
Target Classification | Not Available |
This gene encodes a protein localized to the inner mitochondrial membrane and thought to be involved in the biogenesis of the cytochrome c oxidase complex. The protein is a member of the SURF1 family, which includes the related yeast protein SHY1 and rickettsial protein RP733. The gene is located in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity, where it shares a bidirectional promoter with SURF2 on the opposite strand. Defects in this gene are a cause of Leigh syndrome, a severe neurological disorder that is commonly associated with systemic cytochrome c oxidase deficiency. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.