Human SURF1/CMT4K ORF/cDNA clone-Lentivirus particle (NM_003172)

Cat. No.: vGMLP002818

Pre-made Human SURF1/CMT4K Lentiviral expression plasmid for SURF1 lentivirus packaging, SURF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SURF1/CMT4K products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002818 Human SURF1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002818
Gene Name SURF1
Accession Number NM_003172
Gene ID 6834
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 903 bp
Gene Alias CMT4K
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGGTGGCTGCGTTGCAGCTGGGGCTGCGGGCGGCGGGGCTGGGACGGGCCCCGGCCAGCGCCGCCTGGAGGAGCGTCCTCAGGGTCTCCCCGCGCCCAGGGGTGGCCTGGAGGCCAAGCAGATGTGGCAGTTCTGCAGCAGAAGCATCTGCCACAAAAGCGGAAGATGACTCCTTTCTTCAGTGGGTCCTGCTCCTCATCCCTGTGACTGCCTTTGGCTTGGGGACATGGCAGGTCCAGCGTCGGAAGTGGAAGCTGAACCTGATTGCAGAGTTGGAGTCCAGAGTTCTGGCTGAGCCTGTCCCTCTGCCAGCCGACCCAATGGAACTGAAAAATCTGGAGTATAGGCCAGTGAAGGTCAGGGGGTGCTTTGACCATTCCAAGGAGCTGTATATGATGCCCCGGACCATGGTGGACCCTGTCCGGGAGGCCCGGGAGGGCGGCCTCATCTCCTCCTCAACTCAGAGTGGGGCCTATGTGGTCACTCCCTTCCACTGCACCGACCTGGGAGTCACCATCCTGGTAAATAGAGGGTTCGTTCCCAGGAAGAAAGTGAATCCTGAAACCCGGCAGAAAGGCCAGATTGAGGGAGAAGTGGACCTCATTGGGATGGTGAGGCTGACAGAAACCAGGCAGCCTTTTGTCCCTGAGAACAATCCAGAAAGGAACCACTGGCATTATCGAGACCTGGAAGCTATGGCCAGAATCACAGGCGCAGAGCCCATCTTCATTGATGCCAACTTCCAGAGCACAGTCCCTGGAGGACCCATTGGAGGGCAAACCAGAGTTACTCTGAGGAACGAGCATCTGCAGTACATCGTGACCTGGTATGGACTCTCTGCAGCTACATCCTACCTGTGGTTTAAGAAATTCCTACGTGGGACACCTGGTGTGTGA
ORF Protein Sequence MAAVAALQLGLRAAGLGRAPASAAWRSVLRVSPRPGVAWRPSRCGSSAAEASATKAEDDSFLQWVLLLIPVTAFGLGTWQVQRRKWKLNLIAELESRVLAEPVPLPADPMELKNLEYRPVKVRGCFDHSKELYMMPRTMVDPVREAREGGLISSSTQSGAYVVTPFHCTDLGVTILVNRGFVPRKKVNPETRQKGQIEGEVDLIGMVRLTETRQPFVPENNPERNHWHYRDLEAMARITGAEPIFIDANFQSTVPGGPIGGQTRVTLRNEHLQYIVTWYGLSAATSYLWFKKFLRGTPGV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1858-Ab Anti-SURF1 monoclonal antibody
    Target Antigen GM-Tg-g-IP1858-Ag SURF1 protein
    ORF Viral Vector pGMLP002818 Human SURF1 Lentivirus plasmid
    ORF Viral Vector pGMLP003881 Human SURF1 Lentivirus plasmid
    ORF Viral Vector vGMLP002818 Human SURF1 Lentivirus particle
    ORF Viral Vector vGMLP003881 Human SURF1 Lentivirus particle


    Target information

    Target ID GM-IP1858
    Target Name SURF1
    Gene ID 6834, 20930, 722212, 64463, 101085249, 480681, 100139115
    Gene Symbol and Synonyms 0610010F23Rik,Ab1-205,CMT4K,MC4DN1,SHY1,Surf-1,SURF1
    Uniprot Accession Q15526
    Uniprot Entry Name SURF1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000148290
    Target Classification Not Available

    This gene encodes a protein localized to the inner mitochondrial membrane and thought to be involved in the biogenesis of the cytochrome c oxidase complex. The protein is a member of the SURF1 family, which includes the related yeast protein SHY1 and rickettsial protein RP733. The gene is located in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity, where it shares a bidirectional promoter with SURF2 on the opposite strand. Defects in this gene are a cause of Leigh syndrome, a severe neurological disorder that is commonly associated with systemic cytochrome c oxidase deficiency. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.