Human SURF1 ORF/cDNA clone-Lentivirus plasmid (BC028314)

Cat. No.: pGMLP003881
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SURF1/ Lentiviral expression plasmid for SURF1 lentivirus packaging, SURF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to SURF1/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $525.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003881
Gene Name SURF1
Accession Number BC028314
Gene ID 6834
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 903 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGGTGGCTGCGTTGCAGCTGGGGCTGCGGGCGGCGGGGCTGGGACGGGCCCCGGCCAGCGCCGCCTGGAGGAGCGTCCTCAGGGTCTCCCCGCGCCCAGGGGTGGCCTGGAGGCCAAGCAGATGTGGCAGTTCTGCAGCAGAAGCATCTGCCACAAAAGCGGAAGATGACTCCTTTCTTCAGTGGGTCCTGCTCCTCATCCCTGTGACTGCCTTTGGCTTGGGGACATGGCAGGTCCAGCGTCGGAAGTGGAAGCTGAACCTGATTGCAGAGTTGGAGTCCAGAGTTCTGGCTGAGCCTGTCCCTCTGCCAGCCGATCCAATGGAACTGAAAAATCTGGAGTATAGGCCAGTGAAGGTCAGGGGGTGCTTTGACCATTCCAAGGAGCTGTATATGATGCCCCGGACCATGGTGGACCCTGTCCGGGAGGCCCGGGAGGGCGGCCTCATCTCCTCCTCAACTCAGAGTGGGGCCTATGTGGTCACTCCCTTCCACTGCACCGACCTGGGAGTCACCATCCTGGTAAATAGAGGGTTCGTTCCCAGGAAGAAAGTGAATCCTGAAACCCGGCAGAAAGGCCAGATTGAGGGAGAAGTGGACCTCATTGGGATGGTGAGGCTGACAGAAACCAGGCAGCCTTTTGTCCCTGAGAACAATCCAGAAAGGAACCACTGGCATTATCGAGACCTGGAAGCTATGGCCAGAATCACAGGCGCAGAGCCCATCTTCATTGATGCCAACTTCCAGAGCACAGTCCCTGGAGGACCCATTGGAGGGCAAACCAGAGTTACTCTGAGGAACGAGCATCTGCAGTACATCGTGACCTGGTATGGACTCTCTGCAGCTACATCCTACCTGTGGTTTAAGAAATTCCTACGTGGGACACCTGGTGTGTGA
ORF Protein Sequence MAAVAALQLGLRAAGLGRAPASAAWRSVLRVSPRPGVAWRPSRCGSSAAEASATKAEDDSFLQWVLLLIPVTAFGLGTWQVQRRKWKLNLIAELESRVLAEPVPLPADPMELKNLEYRPVKVRGCFDHSKELYMMPRTMVDPVREAREGGLISSSTQSGAYVVTPFHCTDLGVTILVNRGFVPRKKVNPETRQKGQIEGEVDLIGMVRLTETRQPFVPENNPERNHWHYRDLEAMARITGAEPIFIDANFQSTVPGGPIGGQTRVTLRNEHLQYIVTWYGLSAATSYLWFKKFLRGTPGV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1858-Ab Anti-SURF1 monoclonal antibody
    Target Antigen GM-Tg-g-IP1858-Ag SURF1 protein
    ORF Viral Vector pGMLP002818 Human SURF1 Lentivirus plasmid
    ORF Viral Vector pGMLP003881 Human SURF1 Lentivirus plasmid
    ORF Viral Vector vGMLP002818 Human SURF1 Lentivirus particle
    ORF Viral Vector vGMLP003881 Human SURF1 Lentivirus particle


    Target information

    Target ID GM-IP1858
    Target Name SURF1
    Gene ID 6834, 20930, 722212, 64463, 101085249, 480681, 100139115
    Gene Symbol and Synonyms 0610010F23Rik,Ab1-205,CMT4K,MC4DN1,SHY1,Surf-1,SURF1
    Uniprot Accession Q15526
    Uniprot Entry Name SURF1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000148290
    Target Classification Not Available

    This gene encodes a protein localized to the inner mitochondrial membrane and thought to be involved in the biogenesis of the cytochrome c oxidase complex. The protein is a member of the SURF1 family, which includes the related yeast protein SHY1 and rickettsial protein RP733. The gene is located in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity, where it shares a bidirectional promoter with SURF2 on the opposite strand. Defects in this gene are a cause of Leigh syndrome, a severe neurological disorder that is commonly associated with systemic cytochrome c oxidase deficiency. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.