Human WNT6 ORF/cDNA clone-Lentivirus plasmid (NM_006522)

Pre-made Human WNT6/ Lentiviral expression plasmid for WNT6 lentivirus packaging, WNT6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to WNT6/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002886 Human WNT6 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002886
Gene Name WNT6
Accession Number NM_006522
Gene ID 7475
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1098 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGCCGCCCTTACCCTCCCGCCTCGGGCTGCTGCTGCTGCTGCTCCTGTGCCCGGCGCACGTCGGCGGACTGTGGTGGGCTGTGGGCAGCCCCTTGGTTATGGACCCTACCAGCATCTGCAGGAAGGCACGGCGGCTGGCCGGGCGGCAGGCCGAGTTGTGCCAGGCTGAGCCGGAAGTGGTGGCAGAGCTAGCTCGGGGCGCCCGGCTCGGGGTGCGAGAGTGCCAGTTCCAGTTCCGCTTCCGCCGCTGGAATTGCTCCAGCCACAGCAAGGCCTTTGGACGCATCCTGCAACAGGACATTCGGGAGACGGCCTTCGTGTTCGCCATCACTGCGGCCGGCGCCAGCCACGCCGTCACGCAGGCCTGTTCTATGGGCGAGCTGCTGCAGTGCGGCTGCCAGGCGCCCCGCGGGCGGGCCCCTCCCCGGCCCTCCGGCCTGCCCGGCACCCCCGGACCCCCTGGCCCCGCGGGCTCCCCGGAAGGCAGCGCCGCCTGGGAGTGGGGAGGCTGCGGCGACGACGTGGACTTCGGGGACGAGAAGTCGAGGCTCTTTATGGACGCGCGGCACAAGCGGGGACGCGGAGACATCCGCGCGTTGGTGCAACTGCACAACAACGAGGCGGGCAGGCTGGCCGTGCGGAGCCACACGCGCACCGAGTGCAAATGCCACGGGCTGTCGGGATCATGCGCGCTGCGCACCTGCTGGCAGAAGCTGCCTCCATTTCGCGAGGTGGGCGCGCGGCTGCTGGAGCGCTTCCACGGCGCCTCACGCGTCATGGGCACCAACGACGGCAAGGCCCTGCTGCCCGCCGTCCGCACGCTCAAGCCGCCGGGCCGAGCGGACCTCCTCTACGCCGCCGATTCGCCCGACTTCTGCGCCCCCAACCGACGCACCGGCTCCCCCGGCACGCGCGGTCGCGCCTGCAATAGCAGCGCCCCGGACCTCAGCGGCTGCGACCTGCTGTGCTGCGGCCGCGGGCACCGCCAGGAGAGCGTGCAGCTCGAAGAGAACTGCCTGTGCCGCTTCCACTGGTGCTGCGTAGTACAGTGCCACCGCTGCCGTGTGCGCAAGGAGCTCAGCCTCTGCCTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1938-Ab Anti-WNT6 monoclonal antibody
    Target Antigen GM-Tg-g-MP1938-Ag WNT6 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP1938 wingless-type MMTV integration site family, member 6 (WNT6) protein & antibody
    ORF Viral Vector pGMLP002886 Human WNT6 Lentivirus plasmid
    ORF Viral Vector vGMLP002886 Human WNT6 Lentivirus particle


    Target information

    Target ID GM-MP1938
    Target Name WNT6
    Gene ID 7475, 22420, 700573, 316526, 101099392, 488527, 505075, 100058824
    Gene Symbol and Synonyms Wnt-6,WNT6
    Uniprot Accession Q9Y6F9
    Uniprot Entry Name WNT6_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000115596
    Target Classification Not Available

    The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is overexpressed in cervical cancer cell line and strongly coexpressed with another family member, WNT10A, in colorectal cancer cell line. The gene overexpression may play key roles in carcinogenesis. This gene and the WNT10A gene are clustered in the chromosome 2q35 region. The protein encoded by this gene is 97% identical to the mouse Wnt6 protein at the amino acid level. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.