Human WNT6 ORF/cDNA clone-Lentivirus particle (NM_006522)
Pre-made Human WNT6/ Lentiviral expression plasmid for WNT6 lentivirus packaging, WNT6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to WNT6/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002886 | Human WNT6 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002886 |
Gene Name | WNT6 |
Accession Number | NM_006522 |
Gene ID | 7475 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1098 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGCCGCCCTTACCCTCCCGCCTCGGGCTGCTGCTGCTGCTGCTCCTGTGCCCGGCGCACGTCGGCGGACTGTGGTGGGCTGTGGGCAGCCCCTTGGTTATGGACCCTACCAGCATCTGCAGGAAGGCACGGCGGCTGGCCGGGCGGCAGGCCGAGTTGTGCCAGGCTGAGCCGGAAGTGGTGGCAGAGCTAGCTCGGGGCGCCCGGCTCGGGGTGCGAGAGTGCCAGTTCCAGTTCCGCTTCCGCCGCTGGAATTGCTCCAGCCACAGCAAGGCCTTTGGACGCATCCTGCAACAGGACATTCGGGAGACGGCCTTCGTGTTCGCCATCACTGCGGCCGGCGCCAGCCACGCCGTCACGCAGGCCTGTTCTATGGGCGAGCTGCTGCAGTGCGGCTGCCAGGCGCCCCGCGGGCGGGCCCCTCCCCGGCCCTCCGGCCTGCCCGGCACCCCCGGACCCCCTGGCCCCGCGGGCTCCCCGGAAGGCAGCGCCGCCTGGGAGTGGGGAGGCTGCGGCGACGACGTGGACTTCGGGGACGAGAAGTCGAGGCTCTTTATGGACGCGCGGCACAAGCGGGGACGCGGAGACATCCGCGCGTTGGTGCAACTGCACAACAACGAGGCGGGCAGGCTGGCCGTGCGGAGCCACACGCGCACCGAGTGCAAATGCCACGGGCTGTCGGGATCATGCGCGCTGCGCACCTGCTGGCAGAAGCTGCCTCCATTTCGCGAGGTGGGCGCGCGGCTGCTGGAGCGCTTCCACGGCGCCTCACGCGTCATGGGCACCAACGACGGCAAGGCCCTGCTGCCCGCCGTCCGCACGCTCAAGCCGCCGGGCCGAGCGGACCTCCTCTACGCCGCCGATTCGCCCGACTTCTGCGCCCCCAACCGACGCACCGGCTCCCCCGGCACGCGCGGTCGCGCCTGCAATAGCAGCGCCCCGGACCTCAGCGGCTGCGACCTGCTGTGCTGCGGCCGCGGGCACCGCCAGGAGAGCGTGCAGCTCGAAGAGAACTGCCTGTGCCGCTTCCACTGGTGCTGCGTAGTACAGTGCCACCGCTGCCGTGTGCGCAAGGAGCTCAGCCTCTGCCTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1938-Ab | Anti-WNT6 monoclonal antibody |
Target Antigen | GM-Tg-g-MP1938-Ag | WNT6 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP1938 | wingless-type MMTV integration site family, member 6 (WNT6) protein & antibody |
ORF Viral Vector | pGMLP002886 | Human WNT6 Lentivirus plasmid |
ORF Viral Vector | vGMLP002886 | Human WNT6 Lentivirus particle |
Target information
Target ID | GM-MP1938 |
Target Name | WNT6 |
Gene ID | 7475, 22420, 700573, 316526, 101099392, 488527, 505075, 100058824 |
Gene Symbol and Synonyms | Wnt-6,WNT6 |
Uniprot Accession | Q9Y6F9 |
Uniprot Entry Name | WNT6_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000115596 |
Target Classification | Not Available |
The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is overexpressed in cervical cancer cell line and strongly coexpressed with another family member, WNT10A, in colorectal cancer cell line. The gene overexpression may play key roles in carcinogenesis. This gene and the WNT10A gene are clustered in the chromosome 2q35 region. The protein encoded by this gene is 97% identical to the mouse Wnt6 protein at the amino acid level. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.