Human HTR3A/5-HT-3/ 5-HT3A ORF/cDNA clone-Lentivirus plasmid (NM_213621)

Pre-made Human HTR3A/5-HT-3/ 5-HT3A Lentiviral expression plasmid for HTR3A lentivirus packaging, HTR3A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to HTR3A/5-HT-3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002898 Human HTR3A Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002898
Gene Name HTR3A
Accession Number NM_213621
Gene ID 3359
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1551 bp
Gene Alias 5-HT-3, 5-HT3A, 5-HT3R, 5HT3R, HTR3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTTGGAAAGCTCGCTATGCTGCTGTGGGTCCAGCAGGCGCTGCTCGCCTTGCTCCTCCCCACACTCCTGGCACAGGGAGAAGCCAGGAGGAGCCGAAACACCACCAGGCCCGCTCTGCTGAGGCTGTCGGATTACCTTTTGACCAACTACAGGAAGGGTGTGCGCCCCGTGAGGGACTGGAGGAAGCCAACCACCGTATCCATTGACGTCATTGTCTATGCCATCCTCAACGTGGATGAGAAGAATCAGGTGCTGACCACCTACATCTGGTACCGGCAGTACTGGACTGATGAGTTTCTCCAGTGGAACCCTGAGGACTTTGACAACATCACCAAGTTGTCCATCCCCACGGACAGCATCTGGGTCCCGGACATTCTCATCAATGAGTTCGTGGATGTGGGGAAGTCTCCAAATATCCCGTACGTGTATATTCGGCATCAAGGCGAAGTTCAGAACTACAAGCCCCTTCAGGTGGTGACTGCCTGTAGCCTCGACATCTACAACTTCCCCTTCGATGTCCAGAACTGCTCGCTGACCTTCACCAGTTGGCTGCACACCATCCAGGACATCAACATCTCTTTGTGGCGCTTGCCAGAAAAGGTGAAATCCGACAGGAGTGTCTTCATGAACCAGGGAGAGTGGGAGTTGCTGGGGGTGCTGCCCTACTTTCGGGAGTTCAGCATGGAAAGCAGTAACTACTATGCAGAAATGAAGTTCTATGTGGTCATCCGCCGGCGGCCCCTCTTCTATGTGGTCAGCCTGCTACTGCCCAGCATCTTCCTCATGGTCATGGACATCGTGGGCTTCTACCTGCCCCCCAACAGTGGCGAGAGGGTCTCTTTCAAGATTACACTCCTCCTGGGCTACTCGGTCTTCCTGATCATCGTTTCTGACACGCTGCCGGCCACTGCCATCGGCACTCCTCTCATTGGTAAGGCCCCTCCTGGCAGCAGAGCTCAGTCTGGTGAGAAACCCGCCCCCTCCCACCTCCTGCATGTGTCTCTTGCCTCTGCCCTGGGCTGCACAGGTGTCTACTTTGTGGTGTGCATGGCTCTGCTGGTGATAAGTTTGGCCGAGACCATCTTCATTGTGCGGCTGGTGCACAAGCAAGACCTGCAGCAGCCCGTGCCTGCTTGGCTGCGTCACCTGGTTCTGGAGAGAATCGCCTGGCTACTTTGCCTGAGGGAGCAGTCAACTTCCCAGAGGCCCCCAGCCACCTCCCAAGCCACCAAGACTGATGACTGCTCAGCCATGGGAAACCACTGCAGCCACATGGGAGGACCCCAGGACTTCGAGAAGAGCCCGAGGGACAGATGTAGCCCTCCCCCACCACCTCGGGAGGCCTCGCTGGCGGTGTGTGGGCTGCTGCAGGAGCTGTCCTCCATCCGGCAATTCCTGGAAAAGCGGGATGAGATCCGAGAGGTGGCCCGAGACTGGCTGCGCGTGGGCTCCGTGCTGGACAAGCTGCTATTCCACATTTACCTGCTAGCGGTGCTGGCCTACAGCATCACCCTGGTTATGCTCTGGTCCATCTGGCAGTACGCTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T64591-Ab Anti-5HT3A/ HTR3A/ 5-HT-3 monoclonal antibody
    Target Antigen GM-Tg-g-T64591-Ag HTR3A VLP (virus-like particle)
    ORF Viral Vector pGMLP002898 Human HTR3A Lentivirus plasmid
    ORF Viral Vector vGMLP002898 Human HTR3A Lentivirus particle


    Target information

    Target ID GM-T64591
    Target Name HTR3A
    Gene ID 3359, 15561, 696912, 79246, 101098004, 489399, 617674, 100009690
    Gene Symbol and Synonyms 5-HT-3,5-HT3,5-HT3A,5-HT3R,5HT3,5HT3R,HTR3,HTR3A
    Uniprot Accession P46098
    Uniprot Entry Name 5HT3A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000166736
    Target Classification Not Available

    The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.