Human HTR3A/5-HT-3/ 5-HT3A ORF/cDNA clone-Lentivirus plasmid (NM_213621)
Pre-made Human HTR3A/5-HT-3/ 5-HT3A Lentiviral expression plasmid for HTR3A lentivirus packaging, HTR3A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to HTR3A/5-HT-3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002898 | Human HTR3A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002898 |
Gene Name | HTR3A |
Accession Number | NM_213621 |
Gene ID | 3359 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1551 bp |
Gene Alias | 5-HT-3, 5-HT3A, 5-HT3R, 5HT3R, HTR3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTTGGAAAGCTCGCTATGCTGCTGTGGGTCCAGCAGGCGCTGCTCGCCTTGCTCCTCCCCACACTCCTGGCACAGGGAGAAGCCAGGAGGAGCCGAAACACCACCAGGCCCGCTCTGCTGAGGCTGTCGGATTACCTTTTGACCAACTACAGGAAGGGTGTGCGCCCCGTGAGGGACTGGAGGAAGCCAACCACCGTATCCATTGACGTCATTGTCTATGCCATCCTCAACGTGGATGAGAAGAATCAGGTGCTGACCACCTACATCTGGTACCGGCAGTACTGGACTGATGAGTTTCTCCAGTGGAACCCTGAGGACTTTGACAACATCACCAAGTTGTCCATCCCCACGGACAGCATCTGGGTCCCGGACATTCTCATCAATGAGTTCGTGGATGTGGGGAAGTCTCCAAATATCCCGTACGTGTATATTCGGCATCAAGGCGAAGTTCAGAACTACAAGCCCCTTCAGGTGGTGACTGCCTGTAGCCTCGACATCTACAACTTCCCCTTCGATGTCCAGAACTGCTCGCTGACCTTCACCAGTTGGCTGCACACCATCCAGGACATCAACATCTCTTTGTGGCGCTTGCCAGAAAAGGTGAAATCCGACAGGAGTGTCTTCATGAACCAGGGAGAGTGGGAGTTGCTGGGGGTGCTGCCCTACTTTCGGGAGTTCAGCATGGAAAGCAGTAACTACTATGCAGAAATGAAGTTCTATGTGGTCATCCGCCGGCGGCCCCTCTTCTATGTGGTCAGCCTGCTACTGCCCAGCATCTTCCTCATGGTCATGGACATCGTGGGCTTCTACCTGCCCCCCAACAGTGGCGAGAGGGTCTCTTTCAAGATTACACTCCTCCTGGGCTACTCGGTCTTCCTGATCATCGTTTCTGACACGCTGCCGGCCACTGCCATCGGCACTCCTCTCATTGGTAAGGCCCCTCCTGGCAGCAGAGCTCAGTCTGGTGAGAAACCCGCCCCCTCCCACCTCCTGCATGTGTCTCTTGCCTCTGCCCTGGGCTGCACAGGTGTCTACTTTGTGGTGTGCATGGCTCTGCTGGTGATAAGTTTGGCCGAGACCATCTTCATTGTGCGGCTGGTGCACAAGCAAGACCTGCAGCAGCCCGTGCCTGCTTGGCTGCGTCACCTGGTTCTGGAGAGAATCGCCTGGCTACTTTGCCTGAGGGAGCAGTCAACTTCCCAGAGGCCCCCAGCCACCTCCCAAGCCACCAAGACTGATGACTGCTCAGCCATGGGAAACCACTGCAGCCACATGGGAGGACCCCAGGACTTCGAGAAGAGCCCGAGGGACAGATGTAGCCCTCCCCCACCACCTCGGGAGGCCTCGCTGGCGGTGTGTGGGCTGCTGCAGGAGCTGTCCTCCATCCGGCAATTCCTGGAAAAGCGGGATGAGATCCGAGAGGTGGCCCGAGACTGGCTGCGCGTGGGCTCCGTGCTGGACAAGCTGCTATTCCACATTTACCTGCTAGCGGTGCTGGCCTACAGCATCACCCTGGTTATGCTCTGGTCCATCTGGCAGTACGCTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T64591-Ab | Anti-5HT3A/ HTR3A/ 5-HT-3 monoclonal antibody |
Target Antigen | GM-Tg-g-T64591-Ag | HTR3A VLP (virus-like particle) |
ORF Viral Vector | pGMLP002898 | Human HTR3A Lentivirus plasmid |
ORF Viral Vector | vGMLP002898 | Human HTR3A Lentivirus particle |
Target information
Target ID | GM-T64591 |
Target Name | HTR3A |
Gene ID | 3359, 15561, 696912, 79246, 101098004, 489399, 617674, 100009690 |
Gene Symbol and Synonyms | 5-HT-3,5-HT3,5-HT3A,5-HT3R,5HT3,5HT3R,HTR3,HTR3A |
Uniprot Accession | P46098 |
Uniprot Entry Name | 5HT3A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000166736 |
Target Classification | Not Available |
The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.