- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human HTR3A/5-HT-3/ 5-HT3A ORF/cDNA clone-Lentivirus particle (NM_213621)
Pre-made Human HTR3A/5-HT-3/ 5-HT3A Lentiviral expression plasmid for HTR3A lentivirus packaging, HTR3A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to HTR3A/5-HT-3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP002898 | Human HTR3A Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP002898 |
| Gene Name | HTR3A |
| Accession Number | NM_213621 |
| Gene ID | 3359 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1551 bp |
| Gene Alias | 5-HT-3, 5-HT3A, 5-HT3R, 5HT3R, HTR3 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGCTTGGAAAGCTCGCTATGCTGCTGTGGGTCCAGCAGGCGCTGCTCGCCTTGCTCCTCCCCACACTCCTGGCACAGGGAGAAGCCAGGAGGAGCCGAAACACCACCAGGCCCGCTCTGCTGAGGCTGTCGGATTACCTTTTGACCAACTACAGGAAGGGTGTGCGCCCCGTGAGGGACTGGAGGAAGCCAACCACCGTATCCATTGACGTCATTGTCTATGCCATCCTCAACGTGGATGAGAAGAATCAGGTGCTGACCACCTACATCTGGTACCGGCAGTACTGGACTGATGAGTTTCTCCAGTGGAACCCTGAGGACTTTGACAACATCACCAAGTTGTCCATCCCCACGGACAGCATCTGGGTCCCGGACATTCTCATCAATGAGTTCGTGGATGTGGGGAAGTCTCCAAATATCCCGTACGTGTATATTCGGCATCAAGGCGAAGTTCAGAACTACAAGCCCCTTCAGGTGGTGACTGCCTGTAGCCTCGACATCTACAACTTCCCCTTCGATGTCCAGAACTGCTCGCTGACCTTCACCAGTTGGCTGCACACCATCCAGGACATCAACATCTCTTTGTGGCGCTTGCCAGAAAAGGTGAAATCCGACAGGAGTGTCTTCATGAACCAGGGAGAGTGGGAGTTGCTGGGGGTGCTGCCCTACTTTCGGGAGTTCAGCATGGAAAGCAGTAACTACTATGCAGAAATGAAGTTCTATGTGGTCATCCGCCGGCGGCCCCTCTTCTATGTGGTCAGCCTGCTACTGCCCAGCATCTTCCTCATGGTCATGGACATCGTGGGCTTCTACCTGCCCCCCAACAGTGGCGAGAGGGTCTCTTTCAAGATTACACTCCTCCTGGGCTACTCGGTCTTCCTGATCATCGTTTCTGACACGCTGCCGGCCACTGCCATCGGCACTCCTCTCATTGGTAAGGCCCCTCCTGGCAGCAGAGCTCAGTCTGGTGAGAAACCCGCCCCCTCCCACCTCCTGCATGTGTCTCTTGCCTCTGCCCTGGGCTGCACAGGTGTCTACTTTGTGGTGTGCATGGCTCTGCTGGTGATAAGTTTGGCCGAGACCATCTTCATTGTGCGGCTGGTGCACAAGCAAGACCTGCAGCAGCCCGTGCCTGCTTGGCTGCGTCACCTGGTTCTGGAGAGAATCGCCTGGCTACTTTGCCTGAGGGAGCAGTCAACTTCCCAGAGGCCCCCAGCCACCTCCCAAGCCACCAAGACTGATGACTGCTCAGCCATGGGAAACCACTGCAGCCACATGGGAGGACCCCAGGACTTCGAGAAGAGCCCGAGGGACAGATGTAGCCCTCCCCCACCACCTCGGGAGGCCTCGCTGGCGGTGTGTGGGCTGCTGCAGGAGCTGTCCTCCATCCGGCAATTCCTGGAAAAGCGGGATGAGATCCGAGAGGTGGCCCGAGACTGGCTGCGCGTGGGCTCCGTGCTGGACAAGCTGCTATTCCACATTTACCTGCTAGCGGTGCTGGCCTACAGCATCACCCTGGTTATGCTCTGGTCCATCTGGCAGTACGCTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T64591-Ab | Anti-5HT3A/ HTR3A/ 5-HT-3 monoclonal antibody |
| Target Antigen | GM-Tg-g-T64591-Ag | HTR3A VLP (virus-like particle) |
| ORF Viral Vector | pGMLP002898 | Human HTR3A Lentivirus plasmid |
| ORF Viral Vector | vGMLP002898 | Human HTR3A Lentivirus particle |
Target information
| Target ID | GM-T64591 |
| Target Name | HTR3A |
| Gene ID | 3359, 15561, 696912, 79246, 101098004, 489399, 617674, 100009690 |
| Gene Symbol and Synonyms | 5-HT-3,5-HT3,5-HT3A,5-HT3R,5HT3,5HT3R,HTR3,HTR3A |
| Uniprot Accession | P46098 |
| Uniprot Entry Name | 5HT3A_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000166736 |
| Target Classification | Not Available |
The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
