Human IFNL3/IFN-lambda-3/ IFN-lambda-4 ORF/cDNA clone-Lentivirus plasmid (NM_001346937)

Pre-made Human IFNL3/IFN-lambda-3/ IFN-lambda-4 Lentiviral expression plasmid for IFNL3 lentivirus packaging, IFNL3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IFNL3/IFN-lambda-3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002948 Human IFNL3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002948
Gene Name IFNL3
Accession Number NM_001346937
Gene ID 282617
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 603 bp
Gene Alias IFN-lambda-3, IFN-lambda-4, IL-28B, IL-28C, IL28B, IL28C
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAACTAGACATGACCGGGGACTGCATGCCAGTGCTGGTGCTGATGGCCGCAGTGCTGACCGTGACTGGAGCAGTTCCTGTCGCCAGGCTCCGCGGGGCTCTCCCGGATGCAAGGGGCTGCCACATAGCCCAGTTCAAGTCCCTGTCTCCACAGGAGCTGCAGGCCTTTAAGAGGGCCAAAGATGCCTTAGAAGAGTCGCTTCTGCTGAAGGACTGCAAGTGCCGCTCCCGCCTCTTCCCCAGGACCTGGGACCTGAGGCAGCTGCAGGTGAGGGAGCGCCCCGTGGCTTTGGAGGCTGAGCTGGCCCTGACGCTGAAGGTTCTGGAGGCCACCGCTGACACTGACCCAGCCCTGGGGGATGTCTTGGACCAGCCCCTTCACACCCTGCACCATATCCTCTCCCAGCTCCGGGCCTGTATCCAGCCTCAGCCCACGGCAGGGCCCAGGACCCGGGGCCGCCTCCACCATTGGCTGCACCGGCTCCAGGAGGCCCCAAAAAAGGAGTCCCCTGGCTGCCTCGAGGCCTCTGTCACCTTCAACCTCTTCCGCCTCCTCACGCGAGACCTGAATTGTGTTGCCAGCGGGGACCTGTGTGTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T55242-Ab Anti-IFNL3/ IFN-lambda-3/ IFN-lambda-4 functional antibody
    Target Antigen GM-Tg-g-T55242-Ag IFNL3 protein
    Cytokine cks-Tg-g-GM-T55242 interferon, lambda 3 (IFNL3) protein & antibody
    ORF Viral Vector pGMLP002948 Human IFNL3 Lentivirus plasmid
    ORF Viral Vector vGMLP002948 Human IFNL3 Lentivirus particle


    Target information

    Target ID GM-T55242
    Target Name IFNL3
    Gene ID 282617, 695997, 119870346
    Gene Symbol and Synonyms IFN-lambda-3,IFN-lambda-4,IFNL3,IL-28B,IL-28C,IL28A,IL28B,IL28C
    Uniprot Accession Q8IZI9
    Uniprot Entry Name IFNL3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000197110
    Target Classification Not Available

    This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.