Human IFNL3/IFN-lambda-3/ IFN-lambda-4 ORF/cDNA clone-Lentivirus particle (NM_001346937)
Pre-made Human IFNL3/IFN-lambda-3/ IFN-lambda-4 Lentiviral expression plasmid for IFNL3 lentivirus packaging, IFNL3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to IFNL3/IFN-lambda-3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002948 | Human IFNL3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002948 |
Gene Name | IFNL3 |
Accession Number | NM_001346937 |
Gene ID | 282617 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 603 bp |
Gene Alias | IFN-lambda-3, IFN-lambda-4, IL-28B, IL-28C, IL28B, IL28C |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAACTAGACATGACCGGGGACTGCATGCCAGTGCTGGTGCTGATGGCCGCAGTGCTGACCGTGACTGGAGCAGTTCCTGTCGCCAGGCTCCGCGGGGCTCTCCCGGATGCAAGGGGCTGCCACATAGCCCAGTTCAAGTCCCTGTCTCCACAGGAGCTGCAGGCCTTTAAGAGGGCCAAAGATGCCTTAGAAGAGTCGCTTCTGCTGAAGGACTGCAAGTGCCGCTCCCGCCTCTTCCCCAGGACCTGGGACCTGAGGCAGCTGCAGGTGAGGGAGCGCCCCGTGGCTTTGGAGGCTGAGCTGGCCCTGACGCTGAAGGTTCTGGAGGCCACCGCTGACACTGACCCAGCCCTGGGGGATGTCTTGGACCAGCCCCTTCACACCCTGCACCATATCCTCTCCCAGCTCCGGGCCTGTATCCAGCCTCAGCCCACGGCAGGGCCCAGGACCCGGGGCCGCCTCCACCATTGGCTGCACCGGCTCCAGGAGGCCCCAAAAAAGGAGTCCCCTGGCTGCCTCGAGGCCTCTGTCACCTTCAACCTCTTCCGCCTCCTCACGCGAGACCTGAATTGTGTTGCCAGCGGGGACCTGTGTGTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T55242-Ab | Anti-IFNL3/ IFN-lambda-3/ IFN-lambda-4 functional antibody |
Target Antigen | GM-Tg-g-T55242-Ag | IFNL3 protein |
Cytokine | cks-Tg-g-GM-T55242 | interferon, lambda 3 (IFNL3) protein & antibody |
ORF Viral Vector | pGMLP002948 | Human IFNL3 Lentivirus plasmid |
ORF Viral Vector | vGMLP002948 | Human IFNL3 Lentivirus particle |
Target information
Target ID | GM-T55242 |
Target Name | IFNL3 |
Gene ID | 282617, 695997, 119870346 |
Gene Symbol and Synonyms | IFN-lambda-3,IFN-lambda-4,IFNL3,IL-28B,IL-28C,IL28A,IL28B,IL28C |
Uniprot Accession | Q8IZI9 |
Uniprot Entry Name | IFNL3_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000197110 |
Target Classification | Not Available |
This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.