Human TMBIM1/LFG3/ MST100 ORF/cDNA clone-Lentivirus plasmid (NM_022152)

Pre-made Human TMBIM1/LFG3/ MST100 Lentiviral expression plasmid for TMBIM1 lentivirus packaging, TMBIM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TMBIM1/LFG3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003188 Human TMBIM1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003188
Gene Name TMBIM1
Accession Number NM_022152
Gene ID 64114
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 936 bp
Gene Alias LFG3, MST100, MSTP100, PP1201, RECS1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCAACCCCAGCGCCCCACCACCATATGAAGACCGCAACCCCCTGTACCCAGGCCCTCCGCCCCCTGGGGGCTATGGGCAGCCATCTGTCCTGCCAGGAGGGTATCCTGCCTACCCTGGCTACCCGCAGCCTGGCTACGGTCACCCTGCTGGCTACCCACAGCCCATGCCCCCCACCCACCCGATGCCCATGAACTACGGCCCAGGCCATGGCTATGATGGGGAGGAGAGAGCGGTGAGTGATAGCTTCGGGCCTGGAGAGTGGGATGACCGGAAAGTGCGACACACTTTTATCCGAAAGGTTTACTCCATCATCTCCGTGCAGCTGCTCATCACTGTGGCCATCATTGCTATCTTCACCTTTGTGGAACCTGTCAGCGCCTTTGTGAGGAGAAATGTGGCTGTCTACTACGTGTCCTATGCTGTCTTCGTTGTCACCTACCTGATCCTTGCCTGCTGCCAGGGACCCAGACGCCGTTTCCCATGGAACATCATTCTGCTGACCCTTTTTACTTTTGCCATGGGCTTCATGACGGGCACCATTTCCAGTATGTACCAAACCAAAGCCGTCATCATTGCAATGATCATCACTGCGGTGGTATCCATTTCAGTCACCATCTTCTGCTTTCAGACCAAGGTGGACTTCACCTCGTGCACAGGCCTCTTCTGTGTCCTGGGAATTGTGCTCCTGGTGACTGGGATTGTCACTAGCATTGTGCTCTACTTCCAATACGTTTACTGGCTCCACATGCTCTATGCTGCTCTGGGGGCCATTTGTTTCACCCTGTTCCTGGCTTACGACACACAGCTGGTCCTGGGGAACCGGAAGCACACCATCAGCCCCGAGGACTACATCACTGGCGCCCTGCAGATTTACACAGACATCATCTACATCTTCACCTTTGTGCTGCAGCTGATGGGGGATCGCAATTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1805-Ab Anti-LFG3/ TMBIM1/ MST100 monoclonal antibody
    Target Antigen GM-Tg-g-MP1805-Ag TMBIM1 VLP (virus-like particle)
    ORF Viral Vector pGMAD000119 Human TMBIM1 Adenovirus plasmid
    ORF Viral Vector pGMAD000120 Human TMBIM1 Adenovirus plasmid
    ORF Viral Vector pGMLP003188 Human TMBIM1 Lentivirus plasmid
    ORF Viral Vector vGMAD000119 Human TMBIM1 Adenovirus particle
    ORF Viral Vector vGMAD000120 Human TMBIM1 Adenovirus particle
    ORF Viral Vector vGMLP003188 Human TMBIM1 Lentivirus particle


    Target information

    Target ID GM-MP1805
    Target Name TMBIM1
    Gene ID 64114, 69660, 698325, 316516, 101086997, 102153649, 404134, 100055634
    Gene Symbol and Synonyms 2310061B02Rik,LFG3,mKIAA4161,MST100,MSTP100,PP1201,RECS1,Tmbib1,TMBIM1
    Uniprot Accession Q969X1
    Uniprot Entry Name LFG3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000135926
    Target Classification Not Available

    Enables death receptor binding activity. Involved in negative regulation of Fas signaling pathway; negative regulation of extrinsic apoptotic signaling pathway via death domain receptors; and negative regulation of protein localization to plasma membrane. Located in Golgi apparatus; endosome membrane; and lysosomal membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.