Human TMBIM1/LFG3/ MST100 ORF/cDNA clone-Lentivirus plasmid (NM_022152)
Pre-made Human TMBIM1/LFG3/ MST100 Lentiviral expression plasmid for TMBIM1 lentivirus packaging, TMBIM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TMBIM1/LFG3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003188 | Human TMBIM1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003188 |
Gene Name | TMBIM1 |
Accession Number | NM_022152 |
Gene ID | 64114 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 936 bp |
Gene Alias | LFG3, MST100, MSTP100, PP1201, RECS1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCCAACCCCAGCGCCCCACCACCATATGAAGACCGCAACCCCCTGTACCCAGGCCCTCCGCCCCCTGGGGGCTATGGGCAGCCATCTGTCCTGCCAGGAGGGTATCCTGCCTACCCTGGCTACCCGCAGCCTGGCTACGGTCACCCTGCTGGCTACCCACAGCCCATGCCCCCCACCCACCCGATGCCCATGAACTACGGCCCAGGCCATGGCTATGATGGGGAGGAGAGAGCGGTGAGTGATAGCTTCGGGCCTGGAGAGTGGGATGACCGGAAAGTGCGACACACTTTTATCCGAAAGGTTTACTCCATCATCTCCGTGCAGCTGCTCATCACTGTGGCCATCATTGCTATCTTCACCTTTGTGGAACCTGTCAGCGCCTTTGTGAGGAGAAATGTGGCTGTCTACTACGTGTCCTATGCTGTCTTCGTTGTCACCTACCTGATCCTTGCCTGCTGCCAGGGACCCAGACGCCGTTTCCCATGGAACATCATTCTGCTGACCCTTTTTACTTTTGCCATGGGCTTCATGACGGGCACCATTTCCAGTATGTACCAAACCAAAGCCGTCATCATTGCAATGATCATCACTGCGGTGGTATCCATTTCAGTCACCATCTTCTGCTTTCAGACCAAGGTGGACTTCACCTCGTGCACAGGCCTCTTCTGTGTCCTGGGAATTGTGCTCCTGGTGACTGGGATTGTCACTAGCATTGTGCTCTACTTCCAATACGTTTACTGGCTCCACATGCTCTATGCTGCTCTGGGGGCCATTTGTTTCACCCTGTTCCTGGCTTACGACACACAGCTGGTCCTGGGGAACCGGAAGCACACCATCAGCCCCGAGGACTACATCACTGGCGCCCTGCAGATTTACACAGACATCATCTACATCTTCACCTTTGTGCTGCAGCTGATGGGGGATCGCAATTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1805-Ab | Anti-LFG3/ TMBIM1/ MST100 monoclonal antibody |
Target Antigen | GM-Tg-g-MP1805-Ag | TMBIM1 VLP (virus-like particle) |
ORF Viral Vector | pGMAD000119 | Human TMBIM1 Adenovirus plasmid |
ORF Viral Vector | pGMAD000120 | Human TMBIM1 Adenovirus plasmid |
ORF Viral Vector | pGMLP003188 | Human TMBIM1 Lentivirus plasmid |
ORF Viral Vector | vGMAD000119 | Human TMBIM1 Adenovirus particle |
ORF Viral Vector | vGMAD000120 | Human TMBIM1 Adenovirus particle |
ORF Viral Vector | vGMLP003188 | Human TMBIM1 Lentivirus particle |
Target information
Target ID | GM-MP1805 |
Target Name | TMBIM1 |
Gene ID | 64114, 69660, 698325, 316516, 101086997, 102153649, 404134, 100055634 |
Gene Symbol and Synonyms | 2310061B02Rik,LFG3,mKIAA4161,MST100,MSTP100,PP1201,RECS1,Tmbib1,TMBIM1 |
Uniprot Accession | Q969X1 |
Uniprot Entry Name | LFG3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000135926 |
Target Classification | Not Available |
Enables death receptor binding activity. Involved in negative regulation of Fas signaling pathway; negative regulation of extrinsic apoptotic signaling pathway via death domain receptors; and negative regulation of protein localization to plasma membrane. Located in Golgi apparatus; endosome membrane; and lysosomal membrane. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.