Human FAM57A/CT120 ORF/cDNA clone-Lentivirus plasmid (NM_001318006)

Cat. No.: pGMLP003275
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FAM57A/CT120 Lentiviral expression plasmid for FAM57A lentivirus packaging, FAM57A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to FAM57A/CT120 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $469.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003275
Gene Name FAM57A
Accession Number NM_001318006
Gene ID 79850
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 678 bp
Gene Alias CT120
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCTGACGCTGGCCGGGGGCGCGCTCTTCTTCCCGGGGCTCTTCGCGCTCTGCACCTGGGCGCTGCGCCGCTCCCAGCCCGGATGGAGCCGCACCGACTGCGTGATGATCAGCACCAGGCTGGTTTCCTCGGTGCACGCCGTGCTGGCCACCGGCTCGGGGATCGTCATCATTCGCTCCTGCGACGACGTGATCACCGGCAGGCACTGGCTTGCCCGGGAATATGTGTGGTTTCTGATTCCATACATGATCTATGACTCGTACGCCATGTACCTCTGTGAATGGTGCCGAACCAGAGACCAGAACCGTGCGCCCTCCCTCACTCTTCGAAACTTCCTAAGTCGAAACCGCCTCATGATCACACATCATGCGGTCATTCTCTTTGTCCTTGTGCCAGTCGCACAGCTAAAGCAGCAGCACACCCTTCTGTACAAGGTGAATGGAATCCTCACGCTGGCCACCTTCCTTTCCTGCCGGATCCTTCTCTTCCCCTTCATGTACTGGTCCTATGGCCGCCAGCAGGGACTAAGCCTGCTCCAAGTACCCTTCAGCATCCCATTCTACTGCAACGTGGCCAATGCCTTCCTCGTAGCTCCTCAGATCTACTGGTTCTGTCTGCTGTGCAGGAAGGCAGTCCGGCTCTTTGACACTCCCCAAGCCAAAAAGGATGGCTAA
ORF Protein Sequence MLLTLAGGALFFPGLFALCTWALRRSQPGWSRTDCVMISTRLVSSVHAVLATGSGIVIIRSCDDVITGRHWLAREYVWFLIPYMIYDSYAMYLCEWCRTRDQNRAPSLTLRNFLSRNRLMITHHAVILFVLVPVAQLKQQHTLLYKVNGILTLATFLSCRILLFPFMYWSYGRQQGLSLLQVPFSIPFYCNVANAFLVAPQIYWFCLLCRKAVRLFDTPQAKKDG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0433-Ab Anti-TLC3A/ FAM57A/ CT120 monoclonal antibody
    Target Antigen GM-Tg-g-MP0433-Ag FAM57A VLP (virus-like particle)
    ORF Viral Vector pGMLP003275 Human FAM57A Lentivirus plasmid
    ORF Viral Vector vGMLP003275 Human FAM57A Lentivirus particle


    Target information

    Target ID GM-MP0433
    Target Name FAM57A
    Gene ID 79850, 116972, 699707, 100360533, 101088125, 480642, 508425, 100072283
    Gene Symbol and Synonyms 2310047D13Rik,4932415L08Rik,5430402E13Rik,5430420K21Rik,CT120,FAM57A,RGD1307493,TLCD3A,Wdt3
    Uniprot Accession Q8TBR7
    Uniprot Entry Name TLC3A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000167695
    Target Classification Not Available

    The protein encoded by this gene is a membrane-associated protein that promotes lung carcinogenesis. The encoded protein may be involved in amino acid transport and glutathione metabolism since it can interact with a solute carrier family member (SLC3A2) and an isoform of gamma-glutamyltranspeptidase-like 3. An alternatively spliced variant encoding a protein that lacks a 32 aa internal segment showed the opposite effect, inhibiting lung cancer cell growth. Knockdown of this gene also inhibited lung carcinogenesis and tumor cell growth. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.