Human FAM57A/CT120 ORF/cDNA clone-Lentivirus particle (NM_001318006)
Cat. No.: vGMLP003275
Pre-made Human FAM57A/CT120 Lentiviral expression plasmid for FAM57A lentivirus packaging, FAM57A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
FAM57A/CT120 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003275 | Human FAM57A Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003275 |
Gene Name | FAM57A |
Accession Number | NM_001318006 |
Gene ID | 79850 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 678 bp |
Gene Alias | CT120 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCTGCTGACGCTGGCCGGGGGCGCGCTCTTCTTCCCGGGGCTCTTCGCGCTCTGCACCTGGGCGCTGCGCCGCTCCCAGCCCGGATGGAGCCGCACCGACTGCGTGATGATCAGCACCAGGCTGGTTTCCTCGGTGCACGCCGTGCTGGCCACCGGCTCGGGGATCGTCATCATTCGCTCCTGCGACGACGTGATCACCGGCAGGCACTGGCTTGCCCGGGAATATGTGTGGTTTCTGATTCCATACATGATCTATGACTCGTACGCCATGTACCTCTGTGAATGGTGCCGAACCAGAGACCAGAACCGTGCGCCCTCCCTCACTCTTCGAAACTTCCTAAGTCGAAACCGCCTCATGATCACACATCATGCGGTCATTCTCTTTGTCCTTGTGCCAGTCGCACAGCTAAAGCAGCAGCACACCCTTCTGTACAAGGTGAATGGAATCCTCACGCTGGCCACCTTCCTTTCCTGCCGGATCCTTCTCTTCCCCTTCATGTACTGGTCCTATGGCCGCCAGCAGGGACTAAGCCTGCTCCAAGTACCCTTCAGCATCCCATTCTACTGCAACGTGGCCAATGCCTTCCTCGTAGCTCCTCAGATCTACTGGTTCTGTCTGCTGTGCAGGAAGGCAGTCCGGCTCTTTGACACTCCCCAAGCCAAAAAGGATGGCTAA |
ORF Protein Sequence | MLLTLAGGALFFPGLFALCTWALRRSQPGWSRTDCVMISTRLVSSVHAVLATGSGIVIIRSCDDVITGRHWLAREYVWFLIPYMIYDSYAMYLCEWCRTRDQNRAPSLTLRNFLSRNRLMITHHAVILFVLVPVAQLKQQHTLLYKVNGILTLATFLSCRILLFPFMYWSYGRQQGLSLLQVPFSIPFYCNVANAFLVAPQIYWFCLLCRKAVRLFDTPQAKKDG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0433-Ab | Anti-TLC3A/ FAM57A/ CT120 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0433-Ag | FAM57A VLP (virus-like particle) |
ORF Viral Vector | pGMLP003275 | Human FAM57A Lentivirus plasmid |
ORF Viral Vector | vGMLP003275 | Human FAM57A Lentivirus particle |
Target information
Target ID | GM-MP0433 |
Target Name | FAM57A |
Gene ID | 79850, 116972, 699707, 100360533, 101088125, 480642, 508425, 100072283 |
Gene Symbol and Synonyms | 2310047D13Rik,4932415L08Rik,5430402E13Rik,5430420K21Rik,CT120,FAM57A,RGD1307493,TLCD3A,Wdt3 |
Uniprot Accession | Q8TBR7 |
Uniprot Entry Name | TLC3A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000167695 |
Target Classification | Not Available |
The protein encoded by this gene is a membrane-associated protein that promotes lung carcinogenesis. The encoded protein may be involved in amino acid transport and glutathione metabolism since it can interact with a solute carrier family member (SLC3A2) and an isoform of gamma-glutamyltranspeptidase-like 3. An alternatively spliced variant encoding a protein that lacks a 32 aa internal segment showed the opposite effect, inhibiting lung cancer cell growth. Knockdown of this gene also inhibited lung carcinogenesis and tumor cell growth. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.