Human LAIR1/CD305/LAIR-1 ORF/cDNA clone-Lentivirus plasmid (NM_002287)

Cat. No.: pGMLP003510
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LAIR1/CD305/LAIR-1 Lentiviral expression plasmid for LAIR1 lentivirus packaging, LAIR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to LAIR1/CD305 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $516
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003510
Gene Name LAIR1
Accession Number NM_002287
Gene ID 3903
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 864 bp
Gene Alias CD305,LAIR-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTCCCCACCCCACCGCCCTCCTGGGCCTAGTGCTCTGCCTGGCCCAGACCATCCACACGCAGGAGGAAGATCTGCCCAGACCCTCCATCTCGGCTGAGCCAGGCACCGTGATCCCCCTGGGGAGCCATGTGACTTTCGTGTGCCGGGGCCCGGTTGGGGTTCAAACATTCCGCCTGGAGAGGGACAGTAGATCCACATACAATGATACTGAAGATGTGTCTCAAGCTAGTCCATCTGAGTCAGAGGCCAGATTCCGCATTGACTCAGTAAGAGAAGGAAATGCCGGGCTTTATCGCTGCATCTATTATAAGCCCCCTAAATGGTCTGAGCAGAGTGACTACCTGGAGCTGCTGGTGAAAGAAAGCTCTGGAGGCCCGGACTCCCCGGACACAGAGCCCGGCTCCTCAGCTGGACCCACGCAGAGGCCGTCGGACAACAGTCACAATGAGCATGCACCTGCTTCCCAAGGCCTGAAAGCTGAGCATCTGTATATTCTCATCGGGGTCTCAGTGGTCTTCCTCTTCTGTCTCCTCCTCCTGGTCCTCTTCTGCCTCCATCGCCAGAATCAGATAAAGCAGGGGCCCCCCAGAAGCAAGGACGAGGAGCAGAAGCCACAGCAGAGGCCTGACCTGGCTGTTGATGTTCTAGAGAGGACAGCAGACAAGGCCACAGTCAATGGACTTCCTGAGAAGGACAGAGAGACGGACACCTCGGCCCTGGCTGCAGGGAGTTCCCAGGAGGTGACGTATGCTCAGCTGGACCACTGGGCCCTCACACAGAGGACAGCCCGGGCTGTGTCCCCACAGTCCACAAAGCCCATGGCCGAGTCCATCACGTATGCAGCCGTTGCCAGACACTGA
ORF Protein Sequence MSPHPTALLGLVLCLAQTIHTQEEDLPRPSISAEPGTVIPLGSHVTFVCRGPVGVQTFRLERDSRSTYNDTEDVSQASPSESEARFRIDSVREGNAGLYRCIYYKPPKWSEQSDYLELLVKESSGGPDSPDTEPGSSAGPTQRPSDNSHNEHAPASQGLKAEHLYILIGVSVVFLFCLLLLVLFCLHRQNQIKQGPPRSKDEEQKPQQRPDLAVDVLERTADKATVNGLPEKDRETDTSALAAGSSQEVTYAQLDHWALTQRTARAVSPQSTKPMAESITYAAVARH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T39047-Ab Anti-LAIR1/ CD305/ LAIR-1 monoclonal antibody
    Target Antigen GM-Tg-g-T39047-Ag LAIR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003510 Human LAIR1 Lentivirus plasmid
    ORF Viral Vector pGMLP003875 Human LAIR1 Lentivirus plasmid
    ORF Viral Vector vGMLP003510 Human LAIR1 Lentivirus particle
    ORF Viral Vector vGMLP003875 Human LAIR1 Lentivirus particle


    Target information

    Target ID GM-T39047
    Target Name LAIR1
    Gene ID 3903, 574531, 101081847, 484308, 615295, 102149211
    Gene Symbol and Synonyms CD305,LAIR-1,LAIR1
    Uniprot Accession Q6GTX8
    Uniprot Entry Name LAIR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Pregnant state
    Gene Ensembl ENSG00000167613
    Target Classification Not Available

    The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.